Human cytomegalovirus immediate-early enhancer/promoter (CMV IE promoter)

Strongest widely used constitutive promoter, providing very high ubiquitous transgene expression immediately after delivery across most mammalian cell types. Susceptible to progressive epigenetic silencing in liver, muscle, and brain over weeks to months in vivo. Best reserved for transient transfection or short-term studies where peak expression is prioritized over longevity.

Length: 589 bp

Strength: Very Strong

Tissue: Neuron

Expression: Developmental

Origin: Human CMV

Characteristics

Strong constitutive ubiquitous promoter from HCMV IE gene region. Active in most mammalian cell types; widely used in expression vectors but subject to epigenetic silencing in certain contexts in vivo.

Applications

Best for applications requiring maximum initial expression. Suitable for short-term studies, in vitro work, and most in vivo applications where expression duration is secondary to strength.

Limitations

Placeholder text.

Used in Designs

Sequence

tagttattaatagtaatcaattacggggtcattagttcatagcccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataatgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggagtatttacggtaaactgcccacttggcagtacatcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctggtttagtgaaccgtcagatc

Literature References

  1. Boshart et al. (1985). A very strong enhancer is located upstream of an immediate early gene of human cytomegalovirus. Cell 41:521-530 - Boshart 1985 CMV
  2. Qin et al. (2010). Systematic Comparison of Constitutive Promoters and the Doxycycline-Inducible Promoter. PLoS ONE - Qin 2010 Promoter Comparison