Human cytomegalovirus immediate-early enhancer/promoter (CMV IE promoter)

Viral immediate-early enhancer/promoter from human cytomegalovirus that drives strong, constitutive transcription across most transfected mammalian cell types. One of the most widely used promoters for transient transfection, recombinant protein production, and reporter constructs. Subject to progressive transcriptional silencing in some tissues in vivo.

Length: 589 bp

Strength: strong

Tissue: Ubiquitous — active across most mammalian cell types and tissues, but expression level varies considerably by cell type and silences over time in liver and skeletal muscle in vivo.

Expression: constitutive

Origin: Human cytomegalovirus (HCMV), immediate-early gene region

Characteristics

The 589 bp fragment spans the HCMV major immediate-early enhancer and core promoter, whose tandem repeat elements bind ubiquitous transcription factors (NF-κB, CREB/ATF, AP-1) rather than a tissue-restricted activator, giving broad activity without cell-type targeting (Boshart et al. 1985). In a side-by-side lentiviral GFP reporter comparison across eight mammalian cell lines, CMV drives very strong expression in 293T and CMMT cells but comparatively weak expression in MRC5 fibroblasts and rat mesenchymal stem cells, making it the most cell-type-variable of the constitutive promoters tested (Qin et al. 2010).

Applications: Standard promoter for transient transfection, recombinant protein production, and reporter/Cas9 expression in mammalian cell lines such as HEK293, CHO, and COS. Drives transgenes in plasmid, AAV, lentiviral, and adenoviral vectors. Preferred when peak short-term expression matters more than long-term stability in vivo.

Limitations: Undergoes CpG methylation and silencing in vivo. Adenoviral CMV-driven mRNA in rat muscle drops a further ~240-fold between days 3 and 28 as the promoter methylates (Brooks et al. 2004), and CMV-driven expression silences within weeks in mouse liver, reactivable by NF-κB-inducing stimuli such as LPS (Löser et al. 1998). Strength also varies considerably by cell type (Qin et al. 2010).

Used in

{U6-(gRNA)}*2-(ins) U6-(gRNA)-(ins) U6-(gRNA)-CMV-ZsGreen-pA {U6-(gRNA)}*3-hSyn-mCherry-KASH-hGHpA U6-(gRNA)-hSyn-Cre-P2A-EGFP-KASH-hGHpA U6-(gRNA)-hSyn-EGFP-KASH-hGHpA

Sequence

acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgta

You must be signed in to view the full sequence.

References

Boshart et al. (1985). A very strong enhancer is located upstream of an immediate early gene of human cytomegalovirus. Cell 41:521-530 - Boshart 1985 CMV
Qin et al. (2010). Systematic Comparison of Constitutive Promoters and the Doxycycline-Inducible Promoter. PLoS ONE - Qin 2010 Promoter Comparison