Human elongation factor 1 alpha short form (EFS) promoter
Compact promoter derived from human elongation factor 1-alpha. Provides stable, constitutive expression with reduced silencing compared to viral promoters like CMV.
Characteristics
Compact ~212 bp truncated version of EF1α; ubiquitous but weaker than full-length EF1α. Widely used in cargo-limited AAV and lentiviral vectors where size is a constraint.
Applications
Ideal for AAV applications where promoter size matters. Maintains stable expression over months. Good balance of strength and longevity for chronic disease models.
Used in Designs
Sequence
ggctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgatccggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacagg
Literature References
- Kim et al. (1990). Use of the human elongation factor 1 alpha promoter as a versatile and efficient expression system. Gene - Kim 1990 EF1a Promoter