Human elongation factor 1 alpha short form (EFS) promoter

Compact ubiquitous constitutive promoter derived from a truncation of full-length EF1α, retaining stable long-term expression with significantly lower epigenetic silencing than CMV in dividing cells and in vivo. Widely used in size-constrained vectors including AAV and lentiviral systems.

Length: 232 bp

Strength: Moderate constitutive

Characteristics

Compact ~212 bp truncated version of EF1α; ubiquitous but weaker than full-length EF1α. Widely used in cargo-limited AAV and lentiviral vectors where size is a constraint.

Applications

Ideal for AAV applications where promoter size matters. Maintains stable expression over months. Good balance of strength and longevity for chronic disease models.

Sequence

ggctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgatccggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacagg

Literature References

  1. Kim et al. (1990). Use of the human elongation factor 1 alpha promoter as a versatile and efficient expression system. Gene - Kim 1990 EF1a Promoter