ABE7.10 Adenine Base Editor

First adenine base editor validated in human cells, achieving ~50% A-to-G conversion at positions 4–7 with ≤0.1% indels. Addresses the class of pathogenic mutations responsible for ~48% of disease-causing SNPs. Foundational reference for all subsequent ABE development, using an evolved TadA*–SpCas9 D10A nickase heterodimer.

Length: 1095 bp(365 aa)

Type: Adenine Base Editor

Conversion: A-to-G

Editing window: Positions 4-7

Origin: E. coli TadA adenosine deaminase (evolved through 7 rounds of directed evolution)

Architecture

Evolved TadA deaminase (E. coli tRNA adenosine deaminase) fused to Cas9 D10A nickase. Heterodimer of wild-type TadA and evolved TadA* enables processive deamination.

Characteristics

Achieves ~50% A-to-G editing efficiency at positions 4-7 with >99.9% product purity. Heterodimer of wild-type TadA and evolved TadA* enables processive deamination. Indel formation typically ≤0.1% with minimal bystander editing.

Applications

Corrects A-to-G transition mutations addressing ~48% of known pathogenic SNPs. Complements cytosine base editors for all four transition mutations. Validated for installing disease-suppressing mutations and correcting hereditary disorders in human cells.

Limitations

Editing window positions 4-7 narrower than some applications require. Lower efficiency than ABE8e variants at challenging loci and in primary cells. Slower deamination kinetics can result in incomplete editing before Cas9 dissociates.

Sequence

atgtccgaagtcgagttttcccatgagtactggatgagacacgcattgactctcgcaaagagggcttgggatgaacgcgaggtgcccgtgggggcagtactcgtgcataacaatcgcgtaatcggcgaaggttggaataggccgatcggacgccacgaccccactgcacatgcggaaatcatggcccttcgacagggagggcttgtgatgcagaattatcgacttatcgatgcgacgctgtacgtcacgcttgaaccttgcgtaatgtgcgcgggagctatgattcactcccgcattggacgagttgtattcggtgcccgcgacgccaagacgggtgccgcaggttcactgatggacgtgctgcatcacccaggcatgaaccaccgggtagaaatcacagaaggcatattggcggacgaatgtgcggcgctgttgtccgacttttttcgcatgcggaggcaggagatcaaggcccagaaaaaagcacaatcctctactgactctggtggttcttctggtggttctagcggcagcgagactcccgggacctcagagtccgccacacccgaaagttctggtggttcttctggtggttcttccgaagtcgagttttcccatgagtactggatgagacacgcattgactctcgcaaagagggctcgagatgaacgcgaggtgcccgtgggggcagtactcgtgctcaacaatcgcgtaatcggcgaaggttggaatagggcaatcggactccacgaccccactgcacatgcggaaatcatggcccttcgacagggagggcttgtgatgcagaattatcgacttatcgatgcgacgctgtacgtcacgtttgaaccttgcgtaatgtgcgcgggagctatgattcactcccgcattggacgagttgtattcggtgttcgcaacgccaagacgggtgccgcaggttcactgatggacgtgctgcattacccaggcatgaaccaccgggtagaaatcacagaaggcatattggcggacgaatgtgcggcgctgttgtgttacttttttcgcatgcccaggcaggtctttaacgcccagaaaaaagcacaatcctctactgac

Literature References

  1. Gaudelli NM, Komor AC, Rees HA, et al. (2017). Programmable base editing of A•T to G•C in genomic DNA without DNA cleavage. Nature 551:464-471 - Gaudelli 2017 Adenine Base Editor