Library › Parts › RNA Pol III Promoters › U6 Human U6 snRNA Polymerase III Promoter (U6) RNA polymerase III promoter that drives constitutive expression of small RNAs. Provides strong, stable transcription with precise transcriptional start and termination sites.
acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtac
You must be signed in to view the full sequence.
Sign in / Register
Please enable JavaScript to use the sign-in button.
References
Brummelkamp et al. (2002).
A system for stable expression of short interfering RNAs in mammalian cells.
Science - Brummelkamp 2002 U6 H1
