Library › Parts › RNA Pol III Promoters › H1 Human H1 RNA Polymerase III Promoter (H1) Alternative RNA polymerase III promoter for small RNA expression with tissue-specific activity patterns distinct from U6. Provides reliable transcription for guide RNAs and shRNAs.
acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacg
You must be signed in to view the full sequence.
Sign in / Register
Please enable JavaScript to use the sign-in button.
References
Brummelkamp et al. (2002).
A system for stable expression of short interfering RNAs in mammalian cells.
Science - Brummelkamp 2002 U6 H1
