Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element (WPRE)

Post-transcriptional regulatory element from woodchuck hepatitis virus that increases transgene expression 2–8× by enhancing mRNA stability and nuclear export. Standard inclusion in AAV and lentiviral expression cassettes when maximum protein output is needed and vector size permits.

Length: 598 bp

Subtype: Post-transcriptional

Origin: Woodchuck hepatitis virus (WHV) genome, 3' regulatory region

Mechanism

Three RNA stem-loop domains (alpha, beta, gamma) recruit nuclear RNA export factors to increase CRM1-independent mRNA transport from nucleus to cytoplasm. Also stabilizes the 3' end of the transcript, reducing turnover and increasing ribosome loading. Net effect is 2–8× higher steady-state protein output without changing transcription rate.

Characteristics

592 bp element containing three functional domains (alpha, beta, gamma) that fold into RNA stem-loop structures recognized by export factors. Increases cytoplasmic mRNA accumulation by enhancing CRM1-independent nuclear export and stabilizing the transcript. Produces 2–8× higher protein levels compared to cassettes lacking WPRE, with largest gains in AAV and lentiviral vectors where low copy number limits expression. A widely used point-mutated variant (WPREmut6 or WPRE3, ~247 bp) eliminates the partial X-gene ORF to remove oncogenic risk while retaining ~70–80% of activity.

Applications

Standard element in AAV expression cassettes for gene therapy and research when high protein output is critical. Lentiviral vectors for stable cell line generation and in vivo delivery. Neuronal gene delivery where low transduction efficiency must be compensated by higher per-cell expression. Preferred when vector cargo space is available and maximum expression per transduced cell is the priority.

Limitations

Adds 247–592 bp to the vector cargo, reducing available space in size-constrained AAV cassettes. Full-length WPRE contains a truncated woodchuck hepatitis virus X-gene ORF with oncogenic potential — WPREmut6/WPRE3 is preferred for clinical and in vivo applications. Provides diminishing returns in high-copy plasmid transfection where promoter strength is the limiting factor.

Sequence

cgataatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaagctgacgtcctttccatggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgcatcgg

Literature References

  1. Buck et al. (2020). Recombinant adeno-associated viral vectors (rAAV)-vector elements in ocular gene therapy clinical trials and transgene expression and bioactivity assays. Int J Mol Sci - Buck 2020 Ocular AAV