Sleeping Beauty 100X hyperactive transposase (SB100X)

Hyperactive DNA transposase with 100-fold higher activity than original SB10, engineered through molecular evolution. Optimized DNA-binding and catalytic domains enable robust stable gene transfer in vertebrate cells. Mediates precise cut-and-paste transposition into TA dinucleotide sites with large cargo capacity supporting constructs >10 kb for non-viral gene therapy.

Length: 1023 bp(341 aa)

Recognition site: Terminal inverted repeats (IRs) with direct repeats (DRs)

Directionality: Unidirectional

Efficiency: 100-fold higher activity than SB10 in HeLa cell assays

Origin: Molecular evolution from Sleeping Beauty SB10

Characteristics

Transposition activity 100-fold higher than SB10 in antibiotic-resistance assays in HeLa cells. Catalyzes precise excision and genomic integration via cut-and-paste mechanism targeting TA dinucleotide sites, which are duplicated upon insertion. Recognizes terminal inverted repeats (IRs) containing direct repeats (DRs) flanking transposon cargo. Active across diverse vertebrate systems including human, mouse, and other mammalian cells. Large cargo capacity supports efficient transposition of constructs >10 kb. Enables stable long-term transgene expression through chromosomal integration without viral vectors.

Applications: Non-viral gene therapy vector for stable transgene integration in clinical applications. Genetic modification of T cells for cancer immunotherapy in clinical trials. Insertional mutagenesis screens for cancer gene discovery in mouse models. Generation of knockout mice and rats through transposon-mediated disruption. Stable transgene expression studies requiring long-term chromosomal integration. Gene delivery alternative to viral vectors where immunogenicity and safety concerns limit viral use.

Limitations: Integration shows some preference for transcription units rather than completely random distribution. Multiple transposition events in single genome during mutagenesis screens can complicate analysis. Requires co-delivery of both transposon and transposase components for activity. Integration efficiency lower than viral vectors in some cell types, though substantially improved over earlier Sleeping Beauty versions.

Sequence

atgggaaaatcaaaagaaatcagccaagacctcagaaaaagaattgtagacctccacaagtctggttcatccttgggagcaatttccaaacgcctggcggtaccacgttcatctgtacaaacaatagtacgcaagtataaacaccatgggaccacgcagccgtcataccgctcaggaaggagacgcgttctgtctcctagagatgaacgtactttggtgcgaaaagtgcaaatcaatcccagaacaacagcaaaggaccttgtgaagatgctggaggaaacaggtacaaaagtatctatatccacagtaaaacgagtcctatatcgacataacctgaaaggccactcagcaaggaagaagccactgctccaaaaccgacataagaaagccagactacggtttgcaactgcacatggggacaaagatcgtactttttggagaaatgtcctctggtctgatgaaacaaaaatagaactgtttggccataatgaccatcgttatgtttggaggaagaagggggaggcttgcaagccgaagaacaccatcccaaccgtgaagcacgggggtggcagcatcatgttgtgggggtgctttgctgcaggagggactggtgcacttcacaaaatagatggcatcatggacgcggtgcagtatgtggatatattgaagcaacatctcaagacatcagtcaggaagttaaagcttggtcgcaaatgggtcttccaacacgacaatgaccccaagcatacttccaaagttgtggcaaaatggcttaaggacaacaaagtcaaggtattggagtggccatcacaaagccctgacctcaatcctatagaaaatttgtgggcagaactgaaaaagcgtgtgcgagcaaggaggcctacaaacctgactcagttacaccagctctgtcaggaggaatgggccaaaattcacccaaattattgtgggaagcttgtggaaggctacccgaaacgtttgacccaagttaaacaatttaaaggcaatgctaccaaatactag

You must be signed in to view the full sequence.

References

Ivics et al. (1997). Molecular reconstruction of Sleeping Beauty, a Tc1-like transposon from fish, and its transposition in human cells. Cell - Ivics 1997 Sleeping Beauty
Mates et al. (2009). Molecular evolution of a novel hyperactive Sleeping Beauty transposase enables robust stable gene transfer in vertebrates. Nat Genet - Mates 2009 SB100X