Hyperactive piggyBac transposase (hyPBase)

Engineered hyperactive piggyBac transposase that substantially increases transposition in mammalian cells while preserving precise excision behavior. hyPBase combines seven amino acid substitutions in codon-optimized PBase and achieves 17-fold higher excision and 9-fold higher integration, enabling efficient transgene-free iPSC workflows and non-viral gene engineering.

Length: 1785 bp(595 aa)

Recognition site: TTAA (4 bp)

Directionality: Bidirectional

Efficiency: 17-fold excision and 9-fold integration versus mPBase; ~1% footprint frequency

Origin: Error-prone mutagenesis and combinatorial engineering from mammalian codon-optimized piggyBac transposase (mPBase)

Characteristics

hyPBase was engineered by combining seven amino acid substitutions identified through yeast and mouse ES-cell activity screens. The variant achieves 17-fold higher excision and 9-fold higher integration than mPBase in mammalian assays, with approximately threefold higher transposase protein expression. It preserves hallmark piggyBac behavior including TTAA-targeted bidirectional cut-and-paste transposition and low excision footprint frequency around 1%. This profile increases practical transposition output while retaining reversibility needed for transgene removal workflows.

Applications: hyPBase enables high-efficiency non-viral genome engineering in mammalian cells, including transgene insertion and subsequent clean excision in reprogramming pipelines. It improves production of transgene-free mouse iPSCs compared with wild-type mPBase. The higher activity also supports transposon-based functional genomics, stable cell line generation, and advanced research workflows that require stronger integration/excision performance than native PBase.

Limitations: Higher transposase activity can increase insertion burden if helper exposure is prolonged, so temporal control of transposase delivery is important. Like all piggyBac variants, hyPBase remains constrained by TTAA site dependence and does not provide programmable locus targeting. It also requires co-delivery of donor transposon and helper transposase components, which adds process complexity versus single-vector systems.

Sequence

atgggcagcagcctggacgacgagcacatcctgagcgccctgctgcagagcgacgacgagctggtcggcgaggacagcgacagcgaggtgagcgaccacgtgagcgaggacgacgtgcagtccgacaccgaggaggccttcatcgacgaggtgcacgaggtgcagcctaccagcagcggctccgagatcctggacgagcagaacgtgatcgagcagcccggcagctccctggccagcaacaggatcctgaccctgccccagaggaccatcaggggcaagaacaagcactgctggtccacctccaagcccaccaggcggagcagggtgtccgccctgaacatcgtgagaagccagaggggccccaccaggatgtgcaggaacatctacgaccccctgctgtgcttcaagctgttcttcaccgacgagatcatcagcgagatcgtgaagtggaccaacgccgagatcagcctgaagaggcgggagagcatgacctccgccaccttcagggacaccaacgaggacgagatctacgccttcttcggcatcctggtgatgaccgccgtgaggaaggacaaccacatgagcaccgacgacctgttcgacagatccctgagcatggtgtacgtgagcgtgatgagcagggacagattcgacttcctgatcagatgcctgaggatggacgacaagagcatcaggcccaccctgcgggagaacgacgtgttcacccccgtgagaaagatctgggacctgttcatccaccagtgcatccagaactacacccctggcgcccacctgaccatcgacgagcagctgctgggcttcaggggcaggtgccccttcagggtctatatccccaacaagcccagcaagtacggcatcaagatcctgatgatgtgcgacagcggcaccaagtacatgatcaacggcatgccctacctgggcaggggcacccagaccaacggcgtgcccctgggcgagtactacgtgaaggagctgtccaagcccgtccacggcagctgcagaaacatcacctgcgacaactggttcaccagcatccccctggccaagaacctgctgcaggagccctacaagctgaccatcgtgggcaccgtgagaagcaacaagagagagatccccgaggtcctgaagaacagcaggtccaggcccgtgggcaccagcatgttctgcttcgacggccccctgaccctggtgtcctacaagcccaagcccgccaagatggtgtacctgctgtccagctgcgacgaggacgccagcatcaacgagagcaccggcaagccccagatggtgatgtactacaaccagaccaagggcggcgtggacaccctggaccagatgtgcagcgtgatgacctgcagcagaaagaccaacaggtggcccatggccctgctgtacggcatgatcaacatcgcctgcatcaacagcttcatcatctacagccacaacgtgagcagcaagggcgagaaggtgcagagccggaaaaagttcatgcggaacctgtacatgggcctgacctccagcttcatgaggaagaggctggaggcccccaccctgaagagatacctgagggacaacatcagcaacatcctgcccaaagaggtgcccggcaccagcgacgacagcaccgaggagcccgtgatgaagaagaggacctactgcacctactgtcccagcaagatcagaagaaaggccagcgccagctgcaagaagtgtaagaaggtcatctgccgggagcacaacatcgacatgtgccagagctgtttctga

You must be signed in to view the full sequence.

References

Zhang et al. (2021). Phase I clinical trial of EGFR-specific CAR-T cells generated by the piggyBac transposon system in advanced relapsed/refractory non-small cell lung cancer patients. Journal of Cancer Research and Clinical Oncology - Zhang 2021 PiggyBac CAR-T