Tetracycline-controlled transcriptional silencer (tTS)

Inducible transcriptional silencer providing active repression in Tet-Off gene expression systems. Fusion of E. coli TetR DNA-binding domain with KRAB transcriptional silencer achieves potent, doxycycline-reversible gene suppression at tetO operator sites, complementing tTA activator-based approaches with stronger baseline silencing.

Length: 849 bp (283 aa)

Type: Transcriptional silencer

Function: Inducible gene expression control

Origin: Engineered fusion (E. coli Tn10 TetR + KRAB domain)

Characteristics

Fusion protein combining tetracycline repressor DNA-binding domain with KRAB transcriptional silencer domain. Binds to tetracycline response elements (TRE) containing tetO operator repeats in absence of doxycycline. Upon DNA binding, recruits KRAB-mediated repression machinery including KAP1 corepressor complex, establishing heterochromatin marks and potent transcriptional silencing. Doxycycline binding induces conformational change preventing DNA binding, rapidly derepressing target genes. Provides active silencing compared to passive repression of standard Tet-Off tTA systems. Achieves tight baseline repression with rapid, reversible derepression within hours of doxycycline addition. Functions across diverse mammalian cell types and can be combined with tTA for bidirectional gene control.

Applications: Tet-Off systems requiring active transcriptional repression rather than passive lack of activation. Stringent gene silencing with minimal leaky expression in absence of doxycycline. Combined with tTA for bidirectional control of multiple transgenes in complex genetic circuits. Transgenic models requiring tight baseline suppression and rapid inducible activation. Conditional gene knockdown in developmental studies and disease models. Temporal control of therapeutic gene expression where strong baseline silencing is critical.

Limitations: Requires KRAB domain proximity to transcription start site for effective repression, with optimal positioning from −50 to +300 bp relative to TSS. Silencing efficiency varies with chromatin context, promoter strength, and baseline gene expression. Requires dual-vector delivery (silencer + TRE-driven gene) or genomic integration. Doxycycline at therapeutic concentrations can disrupt mitochondrial protein translation, potentially confounding experimental results. Heterochromatin marks established by KRAB may persist briefly after doxycycline-induced release. Less commonly used than tTA or rtTA systems, limiting availability of optimized reagents.

Sequence

acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgta

You must be signed in to view the full sequence.

References

Gossen et al. (1992). Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc Natl Acad Sci USA - Gossen 1992 Tet-Off