Second-generation tetracycline-controlled transactivator (tTA2)

Second-generation Tet-Off transactivator with enhanced stability and codon optimization for mammalian expression. Fusion of E. coli TetR with minimal F-type activation domains achieves robust transcriptional control while eliminating VP16-associated degradation. Improved protein stability and tetO binding compared to original tTA enable more consistent inducible expression.

Length: 747 bp (249 aa)

Type: Transcriptional activator

Function: Inducible gene expression control

Origin: Synthetic codon-optimized from E. coli TetR

Characteristics

Codon-optimized fusion protein combining tetracycline repressor DNA-binding domain with minimal F-type activation domains. Synthetic gene design eliminates splice donor/acceptor sites and optimizes codon usage for mammalian expression. Exhibits dramatically reduced proteolytic degradation compared to original tTA-VP16 fusion, resulting in greater protein stability in HeLa cells and other mammalian systems. Maintains high-affinity binding to tetO sequences in absence of doxycycline. Doxycycline addition rapidly dissociates tTA2 from DNA, shutting off transcription within hours. Functions with standard TRE (tetracycline response element) promoters containing heptameric tetO repeats. Achieves similar dynamic range to original tTA while providing more consistent expression due to improved stability.

Applications: Conditional gene expression in mammalian cells and transgenic organisms requiring improved transactivator stability. Research applications demanding consistent Tet-Off control across extended time courses. Cell line development where protein degradation of original tTA causes variable expression. Combined with TRE-driven therapeutic genes for inducible expression systems. Developmental studies requiring sustained, reversible transcriptional control.

Limitations: Retains Tet-Off pharmacology requiring continuous doxycycline to maintain suppression, which can confound experiments. Doxycycline at therapeutic concentrations may disrupt mitochondrial translation. Minimal activation domains provide somewhat reduced transcriptional potency compared to full VP16 in some contexts. rtTA variants preferred for in vivo applications due to drug-on logic.

Sequence

acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacg

You must be signed in to view the full sequence.

References

Gossen et al. (1992). Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc Natl Acad Sci USA - Gossen 1992 Tet-Off
Urlinger et al. (2000). Exploring the sequence space for tetracycline-dependent transcriptional activators: novel mutations yield expanded range and sensitivity. Proc. Natl. Acad. Sci. USA - Urlinger 2000 Improved Rtta