Tetracycline-controlled transactivator (tTA)

Foundational inducible transcriptional activator that established reversible gene expression control in mammalian cells. Fusion of E. coli TetR DNA-binding domain with HSV VP16 activation domain enables >10,000-fold transcriptional induction. Adding doxycycline dissociates tTA from tetO sequences within hours, shutting off expression with tight, reversible control.

Length: 1008 bp (336 aa)

Type: Transcriptional activator

Function: Inducible gene expression control

Origin: Engineered fusion (E. coli Tn10 TetR + HSV VP16)

Characteristics

Fusion protein combining tetracycline repressor DNA-binding domain with VP16 minimal activation domain. Binds to tetracycline response elements (TRE) comprising seven 19-bp tetO repeats upstream of minimal promoters. Doxycycline binding induces conformational change that prevents DNA binding. Achieves >10,000-fold induction range in HeLa cells. Reversible expression control within hours of doxycycline addition or removal. Functions across diverse mammalian cell types and transgenic organisms. Forms the basis of the Tet-Off system where drug addition suppresses expression.

Applications: Conditional gene expression in transgenic mice for developmental studies. Reversible gene knockout and rescue experiments. Temporal control of therapeutic gene expression in cell and gene therapy. Dose-dependent transgene regulation in research applications. Combined with Cre-lox for complex genetic manipulation. Functional genomics requiring reversible gene perturbation. Disease models requiring inducible pathology.

Limitations: Requires continuous doxycycline presence to maintain suppression (Tet-Off logic). Doxycycline at therapeutic concentrations can disrupt mitochondrial protein translation in eukaryotic cells, potentially confounding experimental results. Fetal bovine serum must be tested for tetracycline contamination. Expression kinetics slower than post-translational systems like tamoxifen-inducible ER. rtTA (Tet-On) variants preferred for in vivo applications due to inverted pharmacology (drug-on = gene-on).

Sequence

acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgt

You must be signed in to view the full sequence.

References

Gossen et al. (1992). Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc Natl Acad Sci USA - Gossen 1992 Tet-Off