Channelrhodopsin-2 H134R variant

Gain-of-function ChR2 variant with histidine-to-arginine mutation at position 134, producing larger steady-state photocurrents than wild-type. The H134 position corresponds to D96 in bacteriorhodopsin. Increased conductance enables more robust depolarization and sustained high-frequency firing in neurons. First reported in 2005 C. elegans optogenetics experiments, became the most widely used ChR2 variant for neural activation.

Length: 933 bp (311 aa)

Type: Optogenetic actuator

Function: Light-gated cation channel

Origin: Engineered variant of Chlamydomonas reinhardtii ChR2

Characteristics

Single amino acid substitution H134R (histidine to arginine at position 134). Larger stationary photocurrents compared to wild-type ChR2, enabling stronger and more sustained depolarization. Rapid channel opening (τ = 0.96 ± 0.12 ms) and closing kinetics (τ = 20.9 ± 2.2 ms in darkness). Maintains similar rapid desensitization to wild-type. Peak absorption ~480 nm. Non-selective cation channel permeable to H⁺, Na⁺, K⁺, and Ca²⁺.

Applications: High-frequency neural stimulation requiring robust sustained photocurrents. Circuit mapping and optogenetic control in cell types with lower expression levels or higher stimulation thresholds. Behavioral control in C. elegans, rodents, and other model organisms. Standard variant for AAV-delivered optogenetic constructs in neuroscience research. Deep brain stimulation and vision restoration applications requiring maximal light-evoked current.

Limitations: Desensitizes under continuous illumination similar to wild-type ChR2. Blue light (480 nm) has limited tissue penetration. Higher conductance may cause excessive calcium influx in some contexts. For ultra-precise temporal control, fast-kinetic variants like ChETA may be preferred despite lower photocurrent amplitude.

Modifications: H134R point mutation. Requires all-trans retinal chromophore, naturally present at sufficient levels in mammalian tissues.

Sequence

acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgta

You must be signed in to view the full sequence.

References

Nagel et al. (2005). Light activation of channelrhodopsin-2 in excitable cells of Caenorhabditis elegans triggers rapid behavioral responses. Curr Biol - Nagel 2005 ChR2 Excitable