Channelrhodopsin-2 (ChR2)

Revolutionary blue light-activated cation channel that enabled millisecond-precision optical control of neurons, founding the field of optogenetics. Absorbs 480 nm light to depolarize cells expressing this microbial opsin from Chlamydomonas reinhardtii. Requires no chemical cofactors beyond endogenous retinal. The most widely used optogenetic tool for neural activation across model organisms and therapeutic applications.

Length: 933 bp (311 aa)

Type: Optogenetic actuator

Function: Light-gated cation channel

Origin: Chlamydomonas reinhardtii

Characteristics

Seven-transmembrane rhodopsin with peak absorption at 480 nm. Blue light photoisomerizes all-trans retinal chromophore, opening a non-selective cation pore permeable to H⁺, Na⁺, K⁺, and Ca²⁺. Channel opens within milliseconds of illumination and closes upon light offset. Depolarizes mammalian neurons sufficiently to trigger action potentials with millisecond temporal precision. Desensitizes to smaller steady-state conductance under continuous illumination. All-trans retinal chromophore is naturally present at sufficient levels in mammalian brain, requiring no exogenous cofactor addition.

Applications: Millisecond-timescale optical control of neural activity in vitro and in vivo. Circuit mapping via selective photostimulation of defined cell populations. Behavioral control in C. elegans, Drosophila, zebrafish, and rodents. Vision restoration in retinal degeneration and retinitis pigmentosa. Deep brain stimulation for Parkinson's disease. Combined with calcium or voltage indicators for all-optical interrogation of neural circuits.

Limitations: Small single-channel conductance limits sustained high-frequency firing above 20-40 Hz in some cell types without H134R or other conductance-enhancing mutations. Desensitization under continuous blue light reduces steady-state photocurrent. Blue light (480 nm) has limited tissue penetration compared to red-shifted channelrhodopsin variants.

Modifications: Requires all-trans retinal chromophore, naturally present at sufficient levels in mammalian tissues

Sequence

acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgta

You must be signed in to view the full sequence.

References

Nagel et al. (2003). Channelrhodopsin-2, a directly light-gated cation-selective membrane channel. Proc Natl Acad Sci USA - Nagel 2003 Channelrhodopsin