Tetracycline response element (TRE) promoter

Synthetic inducible promoter combining seven tandem tetracycline operator (tetO) sequences upstream of a minimal CMV promoter. It has no activity on its own; it is switched on only when bound by a co-expressed tTA (Tet-Off) or rtTA (Tet-On) transactivator, and switched off (Tet-Off) or on (Tet-On) by tetracycline or doxycycline. Core component of doxycycline-inducible expression systems.

Length: 424 bp

Strength: inducible

Tissue: None inherent — determined by the promoter driving the co-expressed tTA/rtTA transactivator

Expression: inducible

Origin: Synthetic — 7x tetO array fused to a minimal CMV promoter

Characteristics

Contains 7 tandem copies of the 19-bp tet operator sequence immediately upstream of a minimal human cytomegalovirus (CMV) promoter. Alone, the tetO array does not activate the minimal promoter. Paired with tTA (a fusion of the E. coli Tet repressor and the VP16 transactivation domain), the transactivator binds tetO in the absence of tetracycline and stimulated a luciferase reporter more than 10,000-fold above background in HeLa cells, with doxycycline (0-1 ug/mL) suppressing tTA binding and shutting off expression within hours across up to five orders of magnitude of graded control (Tet-Off configuration). Paired instead with rtTA (a reverse-specificity Tet repressor-VP16 fusion), doxycycline addition induces reporter expression more than 1,000-fold, with the transactivator binding tetO only in the drug's presence (Tet-On configuration).

Applications: Used as the inducible promoter driving a transgene of interest in Tet-Off and Tet-On expression systems, including stably integrated reporter lines and transgenic animals, where doxycycline dosing provides reversible, titratable control of transgene expression.

Limitations: Non-functional as a standalone promoter — requires co-expression of a compatible tTA or rtTA transactivator in the same cell to produce any transcription, so it cannot be used as a simple constitutive or autonomous inducible element and adds a second genetic component (and selection burden) to any construct. Basal ("leaky") expression in the uninduced state has been reported and can confound applications requiring complete transgene silencing.

Sequence

acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgt

You must be signed in to view the full sequence.

References

Gossen et al. (1992). Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc Natl Acad Sci USA - Gossen 1992 Tet-Off
Gossen et al. (1995). Transcriptional activation by tetracyclines in mammalian cells. Science - Gossen 1995 Tet-On