Simian virus 40 early enhancer/promoter (SV40 early promoter)

Early promoter from Simian Vacuolating Virus 40 (SV40); constitutively active across a broad range of mammalian cell types. Commonly used to drive selection marker genes in expression vectors.

Length: 344 bp

Characteristics

Constitutive ubiquitous promoter from SV40 early region (~200–300 bp). Contains SV40 ori for episomal replication in COS cells. Widely used as a drug-selection cassette driver in mammalian vectors.

Sequence

ctgtggaatgtgtgtcagttagggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccaggtgtggaaagtccccaggctccccagcaggcagaagtatgcaaagcatgcatctcaattagtcagcaaccatagtcccgcccctaactccgcccatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctctgcctctgagctattccagaagtagtgaggaggcttttttggaggcctaggcttttgcaaaaagct

Literature References

  1. Qin et al. (2010). Systematic Comparison of Constitutive Promoters and the Doxycycline-Inducible Promoter. PLoS ONE - Qin 2010 Promoter Comparison