Caenorhabditis elegans pharynx and intestine in excess (pie-1) gene promoter

The 5' regulatory region of the C. elegans pie-1 gene, encoding a maternal CCCH zinc-finger protein required for germline blastomere identity. The pie-1 promoter is permissive for expression across most germ-cell types (progenitors, meiotic cells, oocytes) and is the standard tool for germline-restricted transgene expression in C. elegans, bypassing somatic silencing of low-copy transgenes.

Length: 1106 bp

Strength: strong

Tissue: Germline-specific; active in germline progenitors, meiotic germ cells, and oocytes, excluded from soma and from the spermatogenic germline compartment

Expression: constitutive

Origin: Caenorhabditis elegans pie-1 gene, 5' upstream region

Characteristics

PIE-1 is a maternal CCCH zinc-finger protein whose loss produces ectopic pharyngeal and intestinal cell fates in the germline blastomere lineage (Mello et al. 1992). Promoters, including pie-1, are permissive for expression across germ-cell types from progenitors through oocytes, with the notable exception that they are not activated during spermatogenesis (Merritt et al. 2008). The pie-1 promoter combined with the pie-1 3' UTR reliably drives low-copy, integrated transgenes during oogenesis for structure-function studies of maternal proteins (Praitis et al. 2001), and pie-1p is used as the dedicated germline promoter alongside the ubiquitous eft-3 promoter in single-copy knock-in systems (Silva-Garcia et al. 2019).

Applications: Standard promoter for germline- and oocyte-restricted transgene expression in C. elegans, used with the pie-1 3' UTR to express reporter and rescue fusions for structure-function studies of maternal proteins, and adopted as the dedicated germline promoter in single-copy knock-in systems (e.g., pie-1p in SKI LODGE), largely bypassing somatic transgene silencing.

Limitations: Not activated during spermatogenesis, so it does not drive expression in the sperm-producing germline compartment. The resulting transcript's fine spatial pattern (e.g., translational repression in the distal gonad) depends heavily on the paired 3' UTR rather than the promoter alone (Merritt et al. 2008).

Sequence

acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtac

You must be signed in to view the full sequence.

References

Merritt et al. (2008). 3' UTRs are the primary regulators of gene expression in the C. elegans germline. Curr Biol - Merritt 2008 3UTR Germline
Silva-García et al. (2019). Single-copy knock-in loci for defined gene expression in Caenorhabditis elegans. G3 (Bethesda) - Silva-García 2019 SKI LODGE