Drosophila melanogaster metallothionein A (Mtn/MtnA) gene promoter

Promoter of the Drosophila melanogaster metallothionein gene Mtn (now MtnA), isolated and sequenced as a copper-inducible cysteine-rich metal-binding protein gene (Lastowski-Perry et al. 1985). Copper and cadmium strongly induce transcription, zinc only weakly; used as a dose-dependent, metal-inducible promoter for transgene expression in cultured Drosophila cells (Bunch et al. 1988).

Length: 427 bp

Strength: inducible

Tissue: Broadly inducible across larval and adult tissues; endogenous induction by copper/cadmium is strongest in the midgut, the primary site of dietary metal exposure and detoxification (Lastowski-Perry et al. 1985).

Expression: inducible

Origin: Drosophila melanogaster Mtn (MtnA) gene

Characteristics

Regulatory region upstream of the 40-amino-acid Mtn (MtnA) metallothionein coding sequence. Copper or cadmium added to the growth medium of cultured Drosophila Schneider (S2) cells induces a 30- to 100-fold increase in Mtn mRNA within hours, sustained over several days, while zinc is a much weaker inducer (Bunch et al. 1988). In stably transfected S2 cells induced with 0.5 mM CuSO4, a -380 to +55 Mtn fragment gives RNA and protein levels comparable to the Act5C distal promoter and three- to fivefold above the alpha1-tubulin promoter; Mtn lines averaged about 700 to 1000 gene copies per cell (Angelichio et al. 1991). Endogenously, copper and cadmium induce Mtn most strongly in the midgut, the main site of dietary metal exposure (Lastowski-Perry et al. 1985).

Applications: Metal-inducible expression system for cultured Drosophila S2 cells, giving dose-dependent transgene induction by adding copper or cadmium to the growth medium (Bunch et al. 1988); copper is generally preferred over cadmium because it is less toxic and does not co-activate the heat-shock response.

Limitations: Cadmium induction is confounded by cadmium's own activation of heat-shock genes and its toxicity at higher doses, so copper is the preferred inducer (Bunch et al. 1988). Expression requires exogenous metal; the S2 comparison used 0.5 mM CuSO4 added on day 4 of a 10-day culture (Angelichio et al. 1991).

Sequence

acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacg

You must be signed in to view the full sequence.

References

Angelichio et al. (1991). Comparison of several promoters and polyadenylation signals for use in heterologous gene expression in cultured Drosophila cells. Nucleic Acids Res - Angelichio 1991 Drosophila Promoters