Mouse phosphoglycerate kinase 1 (mPGK) promoter

Housekeeping promoter from the mouse Pgk1 gene, constitutively active across all mammalian cell types. Provides stable, moderate expression with lower immunogenicity than viral promoters and reduced silencing in embryonic stem cells compared to CMV. Widely used to drive selectable markers in gene targeting vectors and ES cell engineering.

Length: 511 bp

Strength: Moderate

Characteristics

Constitutive, ubiquitous ~500 bp mammalian promoter. Resists silencing by CpG methylation; enables stable long-term expression in transgenic animals and gene therapy vectors.

Applications

Preferred for in vivo applications where immune response is a concern. Good for long-term expression studies in mouse models.

Sequence

ttctaccgggtaggggaggcgcttttcccaaggcagtctggagcatgcgctttagcagccccgctgggcacttggcgctacacaagtggcctctggcctcgcacacattccacatccaccggtaggcgccaaccggctccgttctttggtggccccttcgcgccaccttctactcctcccctagtcaggaagttcccccccgccccgcagctcgcgtcgtgcaggacgtgacaaatggaagtagcacgtctcactagtctcgtgcagatggacagcaccgctgagcaatggaagcgggtaggcctttggggcagcggccaatagcagctttgctccttcgctttctgggctcagaggctgggaaggggtgggtccgggggcgggctcaggggcgggctcaggggcggggcgggcgcccgaaggtcctccggaggcccggcattctgcacgcttcaaaagcgcacgtctgccgcgctgttctcctcttcctcatctccgggcctttcgacct

Literature References

  1. Adra et al. (1987). Cloning and expression of the mouse pgk-1 gene and the nucleotide sequence of its promoter. Gene - Adra 1987 mPGK