Human synapsin 1 (hSyn/SYN1) promoter

Compact 469 bp fragment of the human synapsin 1 (SYN1) gene promoter that restricts transgene expression to neurons in the CNS, with minimal activity in astrocytes and other glia. Standard promoter for AAV- and adenovirus-mediated neuronal gene delivery in rodent and non-human primate brain, widely used in optogenetic and neuroscience gene therapy vectors.

Length: 469 bp

Strength: moderate

Tissue: Neurons (excitatory and inhibitory) throughout the CNS; minimal expression in astrocytes, oligodendrocytes, and non-neural tissue, though specificity varies somewhat by brain region

Expression: constitutive

Origin: Human SYN1 gene, proximal promoter fragment

Characteristics

In adenoviral vectors delivered to adult rat brain, this ~470 bp SYN1 fragment restricts transgene expression almost exclusively to neurons, producing markedly less glial expression than the CMV or U1 snRNA promoters and outperforming the neuron-enriched NSE promoter, which retains some glial activity. The degree of neuronal restriction depends on the brain region transduced, with strong specificity demonstrated in striatum and thalamus, and expression remains stable for months post-injection. Absolute expression levels are lower than strong ubiquitous promoters such as CMV.

Applications: Standard choice for restricting AAV and adenoviral transgene expression to neurons in rodent and non-human primate CNS gene therapy and neuroscience research, including optogenetic and chemogenetic tool delivery to brain and spinal cord where non-neuronal expression must be minimized.

Limitations: Produces lower absolute expression than strong ubiquitous promoters such as CMV, which can limit its use where high transgene dosage is required. Degree of neuronal specificity varies with the brain region transduced. A downstream WPRE element increases expression roughly 3-fold in hippocampal cultures without loss of neuronal specificity, when higher output is needed.

Sequence

acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgta

You must be signed in to view the full sequence.

References

Kügler et al. (2003). Human synapsin 1 gene promoter confers highly neuron-specific long-term transgene expression from an adenoviral vector in the adult rat brain. Gene Ther - Kügler 2003 hSyn
Glover et al. (2002). Adenoviral-mediated, high-level, cell-specific transgene expression: a SYN1-WPRE cassette mediates increased transgene expression with no loss of neuron specificity. Mol Ther - Glover 2002 SYN1-WPRE