Human phosphoglycerate kinase 1 (PGK1) promoter
Housekeeping promoter from the human PGK1 gene, constitutively active across all cell types. Provides moderate, stable expression with substantially lower immunogenicity than viral promoters and minimal silencing over time. Standard choice for co-expressed transgenes, selectable markers, and Cre recombinase in lentiviral and AAV vectors.
Characteristics
Constitutive housekeeping gene promoter (~500 bp); moderate-strength expression in most mammalian cell types. Widely used in selectable marker cassettes and lentiviral vectors.
Applications
Preferred for in vivo applications where immune response is a concern. Good for long-term expression studies. Commonly used in liver and muscle targeting.
Sequence
gggttgcgccttttccaaggcagccctgggtttgcgcagggacgcggctgctctgggcgtggttccgggaaacgcagcggcgccgaccctgggtctcgcacattcttcacgtccgttcgcagcgtcacccggatcttcgccgctacccttgtgggccccccggcgacgcttcctgctccgcccctaagtcgggaaggttccttgcggttcgcggcgtgccggacgtgacaaacggaagccgcacgtctcactagtaccctcgcagacggacagcgccagggagcaatggcagcgcgccgaccgcgatgggctgtggccaatagcggctgctcagcagggcgcgccgagagcagcggccgggaaggggcggtgcgggaggcggggtgtggggcggtagtgtgggccctgttcctgcccgcgcggtgttccgcattctgcaagcctccggagcgcacgtcggcagtcggctccctcgttgaccgaatcaccgacctctctccccagg
Literature References
- Adra et al. (1987). Cloning and expression of the mouse pgk-1 gene and the nucleotide sequence of its promoter. Gene - Adra 1987 mPGK
- Qin et al. (2010). Systematic Comparison of Constitutive Promoters and the Doxycycline-Inducible Promoter. PLoS ONE - Qin 2010 Promoter Comparison
- Kita-Matsuo et al. (2009). Lentiviral Vectors and Protocols for Creation of Stable hESC Lines for Fluorescent Tracking and Drug Resistance Selection of Cardiomyocytes. PLoS ONE - Kita-Matsuo 2009 hESC Cardiomyocyte