Saccharomyces cerevisiae galactose-inducible galactokinase 1 (GAL1) promoter

Galactose-inducible promoter from the divergent GAL1-GAL10 locus of S. cerevisiae. Transcription is repressed on glucose and induced roughly 1,000-fold when cells are switched to galactose, giving tight, high-level control over a heterologous gene. A lacZ fusion on a 2-micron plasmid reaches about 800 U of beta-galactosidase on galactose (Mumberg et al. 1994).

Length: 451 bp

Strength: inducible

Tissue: Not applicable; unicellular S. cerevisiae, active in all cells grown on galactose

Expression: inducible

Origin: Saccharomyces cerevisiae

Characteristics

Divergent promoter shared with GAL10, organized around an upstream activating sequence (UASG) bound by the Gal4 transcriptional activator, which Gal80 holds inactive in the absence of galactose. Expression is induced approximately 1,000-fold on galactose relative to glucose-grown cells and is subject to glucose repression through multiple independent mechanisms, so residual glucose in the medium blocks induction regardless of galactose concentration. In lacZ fusions in strain YPH499 (raffinose pregrowth, then glucose or 4% galactose), centromeric and 2-micron GAL1 plasmids show no significant activity on glucose (Mumberg et al. 1994).

Applications: Conditional expression of recombinant proteins and regulatory circuits in S. cerevisiae, switched on by shifting the carbon source from glucose or raffinose to galactose, on low-copy centromeric or high-copy 2-micron vectors (Mumberg et al. 1994). Shortened GALL and GALS variants with fewer UAS elements give lower but fully repressible activity, down to about 10 U for centromeric GALS (Mumberg et al. 1994).

Limitations: Requires a galactose-containing, glucose-free medium for induction, so the carbon-source shift adds a step not needed with constitutive expression. Very strong expression from full-length GAL1 can be toxic, which motivated the weaker GALL and GALS variants lacking one and one and a half of the three UAS elements (Mumberg et al. 1994).

Sequence

acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacg

You must be signed in to view the full sequence.

References

Mumberg et al. (1994). Regulatable promoters of Saccharomyces cerevisiae: comparison of transcriptional activity and their use for heterologous expression. Nucleic Acids Res - Mumberg 1994 Regulatable Promoters