Caenorhabditis elegans translation elongation factor 1-alpha (eft-3/eef-1A.1) promoter

The 5' regulatory region of the C. elegans eft-3 (eef-1A.1) translation elongation factor gene. Drives broad expression across somatic tissues throughout development and is the standard ubiquitous reference promoter for single-copy transgene insertion (MosSCI) and other genome-engineering constructs in C. elegans.

Length: 608 bp

Strength: strong

Tissue: Ubiquitous across somatic tissues; used as the standard somatic reference promoter, paired with separate dedicated promoters (e.g., pie-1) for germline expression in knock-in systems

Expression: constitutive

Origin: Caenorhabditis elegans eft-3/eef-1A.1 gene, 5' upstream region

Characteristics

eft-3 (eef-1A.1) encodes translation elongation factor 1-alpha; its promoter drives broad somatic expression. In Mos1-mediated single-copy insertion (MosSCI), Peft-3-driven Mos1 transposase increased transgene insertion efficiency more than 6-fold (from 8% to 54% of injected animals) relative to the glh-2 promoter, making it one of the most effective promoters characterized for C. elegans transgenesis. It is used as the ubiquitous/somatic reference promoter in the SKI LODGE single-copy knock-in system, alongside separate tissue-restricted (rab-3, myo-3) and germline-restricted (pie-1) promoters.

Applications: Standard ubiquitous promoter for single-copy transgene insertion via MosSCI and related knock-in systems (e.g., SKI LODGE), driving fluorescent reporters and selection markers broadly across somatic tissues; also used to drive Mos1 transposase expression to improve transgenesis efficiency.

Limitations: Ubiquitous coverage is established across somatic tissues; single-copy knock-in systems built on eft-3 pair it with a separate dedicated germline promoter (pie-1) rather than relying on eft-3 for germline expression, indicating it is not established as reliable for germline-restricted use.

Sequence

acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgt

You must be signed in to view the full sequence.

References

Silva-García et al. (2019). Single-copy knock-in loci for defined gene expression in Caenorhabditis elegans. G3 (Bethesda) - Silva-García 2019 SKI LODGE