Human eukaryotic translation elongation factor 1 alpha 1 (EEF1A1) promoter
Strong ubiquitous promoter (1.2 kb) from human EEF1A1 with superior resistance to epigenetic silencing compared to CMV in both dividing and post-mitotic cells. Preferred for AAV and lentiviral vectors requiring stable long-term expression without promoter attenuation. Lower immunogenicity than CMV makes it the standard housekeeping promoter for human gene therapy applications.
Characteristics
Strong ubiquitous promoter from the human EEF1A1 gene. Resists epigenetic silencing better than CMV in dividing and post-mitotic cells; preferred for stable expression in lentiviral and AAV vectors.
Applications
Broad but less silencing-prone expression than CMV
Sequence
ggctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgaaccggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacaggtaagtgccgtgtgtggttcccgcgggcctggcctctttacgggttatggcccttgcgtgccttgaattacttccacctggctgcagtacgtgattcttgatcccgagcttcgggttggaagtgggtgggagagttcgaggccttgcgcttaaggagccccttcgcctcgtgcttgagttgaggcctggcctgggcgctggggccgccgcgtgcgaatctggtggcaccttcgcgcctgtctcgctgctttcgataagtctctagccatttaaaatttttgatgacctgctgcgacgctttttttctggcaagatagtcttgtaaatgcgggccaagatctgcacactggtatttcggtttttggggccgcgggcggcgacggggcccgtgcgtcccagcgcacatgttcggcgaggcggggcctgcgagcgcggccaccgagaatcggacgggggtagtctcaagctggccggcctgctctggtgcctggtctcgcgccgccgtgtatcgccccgccctgggcggcaaggctggcccggtcggcaccagttgcgtgagcggaaagatggccgcttcccggccctgctgcagggagctcaaaatggaggacgcggcgctcgggagagcgggcgggtgagtcacccacacaaaggaaaagggcctttccgtcctcagccgtcgcttcatgtgactccacggagtaccgggcgccgtccaggcacctcgattagttctcgagcttttggagtacgtcgtctttaggttggggggaggggttttatgcgatggagtttccccacactgagtgggtggagactgaagttaggccagcttggcacttgatgtaattctccttggaatttgccctttttgagtttggatcttggttcattctcaagcctcagacagtggttcaaagtttttttcttccatttcaggtgtcgtga
Literature References
- Kim et al. (1990). Use of the human elongation factor 1 alpha promoter as a versatile and efficient expression system. Gene - Kim 1990 EF1a Promoter
- Qin et al. (2010). Systematic Comparison of Constitutive Promoters and the Doxycycline-Inducible Promoter. PLoS ONE - Qin 2010 Promoter Comparison