Human eukaryotic translation elongation factor 1 alpha 1 (EEF1A1) promoter

Constitutive promoter from the human EEF1A1 gene (elongation factor 1 alpha), a housekeeping gene expressed in essentially all cell types. Drives strong, stable transgene expression that resists the silencing seen with viral promoters, making it a standard choice for lentiviral and AAV vectors intended for long-term expression in dividing and non-dividing human cells.

Length: 1179 bp

Strength: strong

Tissue: Ubiquitous — active in essentially all human cell types, including dividing and post-mitotic cells and hematopoietic progenitors.

Expression: constitutive

Origin: Human EEF1A1 gene promoter/first-intron region

Characteristics

Comprises the EEF1A1 core promoter and part of the first intron, driving transcription from a housekeeping gene locus rather than a viral enhancer (Kim et al. 1990). In a side-by-side lentiviral reporter comparison across eight mammalian cell lines, EF1A is one of the consistently strongest of the constitutive promoters tested, matching or slightly exceeding CAG depending on cell type, and its output is more consistent across cell types than CMV's (Qin et al. 2010). In lentivirally transduced human CD34+ hematopoietic progenitors, EF1A and PGK give sharp, uniform GFP-positive populations, while CMV yields only a small, heterogeneous fraction (Ramezani et al. 2000).

Applications: Standard choice for lentiviral and AAV vectors needing stable long-term expression in human hematopoietic stem/progenitor cells, embryonic stem cells, and other cell types prone to CMV silencing. Used to drive Cas9, fluorescent reporters, and therapeutic transgenes where expression must persist through cell division and differentiation rather than peak transiently.

Limitations: At roughly 1.2 kb, larger than compact alternatives such as the EFS/EF1a-short variant, which constrains its use in size-limited AAV cassettes. Expression is somewhat weaker than CAG in some cell types and stronger in others, so relative ranking against CAG depends on the target cell line (Qin et al. 2010).

Sequence

acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacg

You must be signed in to view the full sequence.

References

Kim et al. (1990). Use of the human elongation factor 1 alpha promoter as a versatile and efficient expression system. Gene - Kim 1990 EF1a Promoter
Qin et al. (2010). Systematic Comparison of Constitutive Promoters and the Doxycycline-Inducible Promoter. PLoS ONE - Qin 2010 Promoter Comparison