Human eukaryotic translation elongation factor 1 alpha 1 (EEF1A1) promoter

Strong ubiquitous promoter (1.2 kb) from human EEF1A1 with superior resistance to epigenetic silencing compared to CMV in both dividing and post-mitotic cells. Preferred for AAV and lentiviral vectors requiring stable long-term expression without promoter attenuation. Lower immunogenicity than CMV makes it the standard housekeeping promoter for human gene therapy applications.

Length: 1179 bp

Strength: Strong

Characteristics

Strong ubiquitous promoter from the human EEF1A1 gene. Resists epigenetic silencing better than CMV in dividing and post-mitotic cells; preferred for stable expression in lentiviral and AAV vectors.

Applications

Broad but less silencing-prone expression than CMV

Sequence

ggctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgaaccggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacaggtaagtgccgtgtgtggttcccgcgggcctggcctctttacgggttatggcccttgcgtgccttgaattacttccacctggctgcagtacgtgattcttgatcccgagcttcgggttggaagtgggtgggagagttcgaggccttgcgcttaaggagccccttcgcctcgtgcttgagttgaggcctggcctgggcgctggggccgccgcgtgcgaatctggtggcaccttcgcgcctgtctcgctgctttcgataagtctctagccatttaaaatttttgatgacctgctgcgacgctttttttctggcaagatagtcttgtaaatgcgggccaagatctgcacactggtatttcggtttttggggccgcgggcggcgacggggcccgtgcgtcccagcgcacatgttcggcgaggcggggcctgcgagcgcggccaccgagaatcggacgggggtagtctcaagctggccggcctgctctggtgcctggtctcgcgccgccgtgtatcgccccgccctgggcggcaaggctggcccggtcggcaccagttgcgtgagcggaaagatggccgcttcccggccctgctgcagggagctcaaaatggaggacgcggcgctcgggagagcgggcgggtgagtcacccacacaaaggaaaagggcctttccgtcctcagccgtcgcttcatgtgactccacggagtaccgggcgccgtccaggcacctcgattagttctcgagcttttggagtacgtcgtctttaggttggggggaggggttttatgcgatggagtttccccacactgagtgggtggagactgaagttaggccagcttggcacttgatgtaattctccttggaatttgccctttttgagtttggatcttggttcattctcaagcctcagacagtggttcaaagtttttttcttccatttcaggtgtcgtga

Literature References

  1. Kim et al. (1990). Use of the human elongation factor 1 alpha promoter as a versatile and efficient expression system. Gene - Kim 1990 EF1a Promoter
  2. Qin et al. (2010). Systematic Comparison of Constitutive Promoters and the Doxycycline-Inducible Promoter. PLoS ONE - Qin 2010 Promoter Comparison