Drosophila melanogaster heat-shock protein 70 (Hsp70) promoter

Promoter of the Drosophila melanogaster Hsp70 heat-shock gene; heat-shock factor (HSF) binds a heat-shock element (HSE) located 47-66 bp upstream of the TATA box to drive rapid, high-level transcription upon a shift to 36-37C (Pelham 1982). Widely used as an inducible driver in Drosophila transgenics, including as the hsp70-derived core/basal promoter in GAL4/UAS vectors (Brand and Perrimon 1993).

Length: 468 bp

Strength: inducible

Tissue: Ubiquitous — all tissues respond to heat shock via HSF-dependent HSE activation, and the closely related Hsp70Bb promoter also shows ubiquitous basal (uninduced) activity at standard rearing temperature (Warsinger-Pepe et al. 2023).

Expression: inducible

Origin: Drosophila melanogaster Hsp70 heat-shock gene

Characteristics

Heat-shock factor binds a conserved HSE motif 47-66 bp upstream of the TATA box to activate transcription (Pelham 1982). First shown to drive a heterologous reporter (hsp70-lacZ) in transgenic Drosophila via P-element transformation, inducing new heat-shock chromosome puffs at each integration site tested (Lis et al. 1983). The core promoter fragment (transcription start site plus 5' UTR, HSEs removed) also serves as the minimal promoter downstream of UAS sites in the GAL4/UAS system (Brand and Perrimon 1993). Despite its heat-inducibility, the closely related Hsp70Bb promoter shows measurable basal ('leaky') transcription at standard rearing temperatures (18-26C) without heat shock (Warsinger-Pepe et al. 2023).

Applications: Inducible driver for temporally controlled transgene expression in Drosophila, activated by a 36-37C heat shock (Pelham 1982; Lis et al. 1983); the hsp70 core/basal promoter fragment is also the standard minimal promoter downstream of UAS sites in GAL4/UAS targeted gene expression constructs (Brand and Perrimon 1993).

Limitations: Shows leaky basal expression at normal rearing temperatures (18-26C) without heat shock, documented for the closely related Hsp70Bb promoter and limiting use where a strict off-state is required (Warsinger-Pepe et al. 2023). Heat shock itself is a physiological stressor that alters broad gene expression and can confound phenotypes attributed to the transgene.

Sequence

acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgt

You must be signed in to view the full sequence.

References

Brand et al. (1993). Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development - Brand 1993 GAL4 UAS
Warsinger-Pepe et al. (2023). Polycomb response elements reduce leaky expression of Cas9 under temperature-inducible Hsp70Bb promoter in Drosophila melanogaster. G3 (Bethesda) - Warsinger-Pepe 2023 Hsp70Bb Leaky Cas9