Mouse alpha-calcium/calmodulin-dependent protein kinase II (CaMKIIα) promoter (1.3 kb)

Compact 1.3 kb fragment of the mouse Camk2a gene promoter that restricts AAV and lentiviral transgene expression predominantly to excitatory pyramidal neurons in cortex and hippocampus. Widely used to drive optogenetic and chemogenetic constructs in forebrain circuits; also produces detectable expression in a subset of cortical GABAergic interneurons.

Length: 1337 bp

Strength: strong

Tissue: Excitatory pyramidal neurons in cortex and hippocampus; also expressed in a subset of cortical GABAergic interneurons (parvalbumin, somatostatin, nNOS, NPY subtypes)

Expression: constitutive

Origin: Mouse Camk2a gene, 1.3 kb proximal promoter fragment

Characteristics

In lentiviral vectors, CaMKIIα promoter fragments of 0.4, 1.3, and 2.4 kb all restrict expression to cortical pyramidal neurons, with the 1.3 kb fragment producing roughly twice the activity of the 2.4 kb fragment, likely due to an inhibitory element present in the longer sequence. Despite its design for excitatory-neuron restriction, AAV vectors carrying a CaMKIIα promoter also drive detectable reporter or opsin expression in parvalbumin-, somatostatin-, nNOS-, and NPY-positive cortical GABAergic interneurons, collectively covering roughly half of the cortical inhibitory neuron population; this off-target expression is sufficient to drive light-evoked spiking when paired with channelrhodopsin-2.

Applications: Standard promoter for restricting optogenetic (e.g., channelrhodopsin-2), chemogenetic, and reporter transgene expression to excitatory neurons in AAV and lentiviral vectors delivered to mouse cortex and hippocampus, used for circuit-mapping and behavioral neuroscience studies.

Limitations: Not fully restricted to excitatory neurons — AAV vectors packaged with the CaMKIIα promoter also express in parvalbumin-, somatostatin-, nNOS-, and NPY-positive cortical interneurons, together covering about half of the cortical inhibitory population. This off-target expression can confound experiments that assume purely excitatory targeting, particularly with sensitive effectors such as channelrhodopsin-2.

Sequence

acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgta

You must be signed in to view the full sequence.

References

Veres et al. (2023). CaMKIIα promoter-controlled circuit manipulations target both pyramidal cells and inhibitory interneurons in cortical networks. eNeuro - Veres 2023 CaMKIIα Interneurons