Rabbit β-Globin (rBG) PolyA Signal

Natural polyadenylation signal from the rabbit β-globin gene (56 bp) with ~100% transcription termination efficiency and 1.4–2.5-fold increase in polyadenylated RNA over baseline. Ultra-compact size makes it suitable for size-critical AAV vectors, and it serves as the evolutionary template for the synthetic SPA signal. High efficiency with minimal sequence footprint.

Length: 56 bp

Efficiency: Very High

Transcript stability: Exceptionally efficient termination and polyadenylation resulting in stable, properly processed mRNA

Origin: Rabbit β-globin gene 3' untranslated region

Characteristics

Natural highly efficient polyA signal containing all elements required for efficient cleavage and polyadenylation. Signals >90% of polyadenylation events when tested. Increases fraction of polyadenylated viral RNAs by 1.4-2.5 fold. Nearly 100% transcription termination efficiency. Contains position-dependent downstream elements required for efficient 3' end formation. Serves as template for synthetic polyA optimization.

Applications

Applications requiring maximum polyadenylation and termination efficiency. Template for designing minimal synthetic polyA signals. Transgenic animals and stable cell line generation. Used when transcription termination efficiency is critical parameter.

Limitations

Moderate size (~94 bp) larger than synthetic but smaller than SV40/bGH. Less commonly available in commercial vectors. Position-dependent efficiency may require optimization in novel contexts.

Sequence

aataaaggaaatttattttcattgcaatagtgtgttggaattttttgtgtctctca

Literature References

  1. Lanoix & Acheson (1988). A rabbit beta-globin polyadenylation signal directs efficient termination of transcription of polyomavirus DNA. EMBO J - Lanoix 1988 Rabbit Beta-Globin