Human Growth Hormone (hGH) PolyA Signal

The polyadenylation signal derived from the 3' flanking region of the human growth hormone (hGH) gene, as sequenced by DeNoto et al. (1981). A ~250 bp cassette containing the AATAAA hexamer and downstream cleavage/termination elements. Widely used in AAV and other gene therapy vectors as a compact, efficient terminator.

Length: 477 bp

Efficiency: High

Transcript stability: Good — confers stable mRNA 3' ends in mammalian cells with comparable performance to SV40 polyA. Preferred in size-constrained vectors (e.g., AAV) where the ~250 bp footprint is acceptable.

Origin: Human growth hormone gene (GH1), 3' flanking region

Characteristics

~477 bp fragment (size varies by restriction sites used in specific plasmid lineages). Contains canonical AATAAA hexamer and downstream U/GU-rich elements required for cleavage factor recognition. Functions efficiently in a wide range of mammalian cell types. Slightly larger than SV40 polyA but preferred in many AAV vector designs for its reliability and human sequence origin.

Applications

Standard terminator in AAV expression cassettes where size constraints rule out larger signals like bGHpA (~230 bp, but with additional upstream sequence often included). Also used in lentiviral vectors, plasmid expression systems, and transgenic constructs. Human sequence origin avoids potential immune concerns in gene therapy contexts.

Limitations

Not the strongest polyA signal — bGHpA outperforms it in direct mammalian cell expression comparisons (Pfarr et al. 1986). For maximum expression from plasmid transfection, bGHpA or SV40 polyA may be preferred. hGHpA is chosen primarily for its compact size and human-origin sequence, not peak performance.

Sequence

gggtggcatccctgtgacccctccccagtgcctctcctggccctggaagttgccactccagtgcccaccagccttgtcctaataaaattaagttgcatcattttgtctgactaggtgtccttctataatattatggggtggaggggggtggtatggagcaaggggcaagttgggaagacaacctgtagggcctgcggggtctattgggaaccaagctggagtgcagtggcacaatcttggctcactgcaatctccgcctcctgggttcaagcgattctcctgcctcagcctcccgagttgttgggattccaggcatgcatgaccaggctcagctaatttttgtttttttggtagagacggggtttcaccatattggccaggctggtctccaactcctaatctcaggtgatctacccaccttggcctcccaaattgctgggattacaggcgtgaaccactgctcccttccctgtcctt

Literature References

  1. DeNoto et al. (1981). Human growth hormone DNA sequence and mRNA structure: possible alternative splicing. Nucleic Acids Res - DeNoto 1981 hGH Gene