Bovine Growth Hormone Polyadenylation Signal

Compact and highly efficient polyadenylation signal from bovine growth hormone gene, widely used in AAV and size-constrained vectors.

Length: 225 bp

Efficiency: High

Origin: Bovine growth hormone (bGH) gene 3' untranslated region

Characteristics

Compact size (~224 bp) ideal for size-constrained vectors. Contains AAUAAA hexanucleotide with diffuse efficiency element rather than discrete GU/U-rich motifs. Forms extensive hairpin loop structure important for function. Provides efficient transcript cleavage and polyadenylation. Demonstrates 3-fold higher expression than SV40 early polyA in some mammalian cell types. Standard terminator in AAV and lentiviral vectors.

Applications

Preferred polyA signal for AAV vectors due to compact size. Standard in most commercial gene therapy vectors. Compatible with all mammalian promoters. Widely validated for in vivo and ex vivo applications. Default choice when vector size optimization is critical.

Limitations

Contains homopurine-rich tracts susceptible to nuclease attack in some contexts. Secondary structure requirements may be disrupted by surrounding sequences. Slightly less characterized than SV40 polyA in academic literature.

Sequence

ctgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctctatgg

Literature References

  1. Goodwin & Rottman (1992). The 3'-flanking sequence of the bovine growth hormone gene contains novel elements required for efficient and accurate polyadenylation. J Biol Chem - Goodwin 1992 bGH PolyA