Bovine Growth Hormone (bGH) PolyA Signal

Compact (225 bp) polyadenylation signal from bovine growth hormone with 3-fold higher expression than SV40 early polyA in key mammalian cell types. Size advantage over SV40 polyA makes it the preferred terminator for AAV vectors with limited cargo space. Standard terminator in commercial gene therapy and lentiviral vector platforms with decades of in vivo validation.

Length: 225 bp

Efficiency: High

Transcript stability: Efficient mRNA processing and nuclear export with good stability

Origin: Bovine growth hormone (bGH) gene 3' untranslated region

Characteristics

Compact size (~224 bp) ideal for size-constrained vectors. Contains AAUAAA hexanucleotide with diffuse efficiency element rather than discrete GU/U-rich motifs. Forms extensive hairpin loop structure important for function. Provides efficient transcript cleavage and polyadenylation. Demonstrates 3-fold higher expression than SV40 early polyA in some mammalian cell types. Standard terminator in AAV and lentiviral vectors.

Applications

Preferred polyA signal for AAV vectors due to compact size. Standard in most commercial gene therapy vectors. Compatible with all mammalian promoters. Widely validated for in vivo and ex vivo applications. Default choice when vector size optimization is critical.

Limitations

Contains homopurine-rich tracts susceptible to nuclease attack in some contexts. Secondary structure requirements may be disrupted by surrounding sequences. Slightly less characterized than SV40 polyA in academic literature.

Sequence

ctgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactcccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggacagcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctctatgg

Literature References

  1. Goodwin & Rottman (1992). The 3'-flanking sequence of the bovine growth hormone gene contains novel elements required for efficient and accurate polyadenylation. J Biol Chem - Goodwin 1992 bGH PolyA
  2. Pfarr et al. (1986). Differential effects of polyadenylation regions on gene expression in mammalian cells. DNA - Pfarr 1986 PolyA Comparison