Ruminiclostridium herbifermentans Cas12f

RhCas12f is a compact CRISPR nuclease with unique gRNA architecture where stem 2 participates in dual recognition of both PAM sequence and protein stabilization. It exhibits the highest RuvC domain flexibility among characterized Cas12f orthologs.

Length: 1245 bp(415 aa)

PAM: NCCD

Cut type: 5-prime overhang

Effector domain: RuvC

Origin: Ruminiclostridium herbifermentans

Characteristics

Compact Cas12f nuclease with highly flexible RuvC domains that remain unresolved in cryo-EM structures. Both RuvC.1 and RuvC.2 show structural plasticity throughout R-loop formation. Stem 2 of gRNA contains 90° kink that docks into REC/WED groove and contacts PAM-interacting residues of monomer 2 via sequence matching PAM (dual PAM/gRNA recognition). Deletion of stem 2 flexible region (Δ50-60 nt) significantly reduces activity. Shows approximately equal preference for target vs non-target strand cleavage (45% NTS). Slow exit from nonproductive EDx state.

Applications

AAV-compatible genome editing, research into CRISPR mechanism and gRNA-protein interactions. Model system for studying dual recognition mechanisms in CRISPR systems.

Limitations

Both RuvC domains highly flexible with undefined positions during catalysis. Slow transition from EDx nonproductive state (0.001 s⁻¹ forward rate). Biphasic cleavage kinetics with low amplitude. Critical dependence on stem 2 flexible region for activity. No significant strand preference may affect predictability of editing outcomes.

Sequence

atgattaccgtgcggaagctgaagatccttatagacggagagagccgcaatgaatcttataaattcatccgagacagtatgtacgcacagtatttggcactcaacaaagctatgtcttacctggggaccgcctaccttagtcgtgacaaggaaatatttaaggaagcgattaagagcttgaacaactccaatcccatttttgataacatcaattttggcaaggggattgacaccaaatcctctgtaaatcagactgtaaaaaagcatattcaggcagacataaaaaatggcctcgcaaagggggagcgctccatccgcaactataagagggactaccccctgatgacccggggccgcgaccttaagttcttttactgcgacacgaattccacaaaagtcaaggtgaagtgggttaatggaataatatttgatgtgatgctgggcaaggagtataataagaacgatctcgagctgcgaagctttttaaatagagttatcaataaagagtacaagatctcacagtcttccatatgcttcgacaagcacaaccggctgattctgaatctttctgtcaacattaccgataatattcccaatgaagttgtcaaaggaagaattgtgggagtggaccttggaatgaaaattcctgcctacgtaacattaaacgattccgaatatatcggaaagccgataggtgatataaacgactttctgaaggtgcgcaagcagttcaaagagagaaaggagcgcttgcagaagcagctggccatcaataaaggaggcaggggaatcacgaataagatgcaattaatggatgcgtttacaaataaggagaagaatttcgcaaacacctataaccacggggtgagcaaggcgatcattaatttcgcaaagaagtacaaggccgagcagatcaacgtggagtttctcgctctggccgggtccgagaaggaaatcttgagctctactatccggtactggtcctactatcaactgcagcagatgattgagtacaaagctaatcgtgagggcatagctgtgaaatatgtagacccttacctgacgtcccagacctgctgtaaatgcggaaactacgaagttggccagcgcatcaaccaagaactttttgagtgtaagctgtgcggcaacaagatgaacgcagaccgcaatgccagtttcaatatcgcccggagtacaaaatacatttcttctaaagaggaaagcgacttctacaagcaactcaaa

Literature References

  1. Guan et al. (2025). Comparative characterization of Cas12f orthologs reveals mechanistic features underlying enhanced genome editing efficiency. Nat. Struct. Mol. Biol. - Guan 2025 Cas12f Orthologs

Related collections

1 4