Oscillibacter sp. Cas12f

OsCas12f is a compact CRISPR nuclease characterized through comparative structural and kinetic analyses with other Cas12f orthologs. It exhibits a unique RuvC-dependent R-loop completion mechanism.

Length: 1506 bp(502 aa)

PAM: YTTH

Cut type: 5-prime overhang

Effector domain: RuvC

Origin: Oscillibacter sp.

Characteristics

Compact Cas12f nuclease (433 aa) with distinct activation mechanism. Requires RuvC.2 domain docking at 8-bp R-loop intermediate for full R-loop formation through two-lid opening mechanism (residues 229-231, 334-343). Contains four-stem-loop gRNA architecture. Stem 4 deletion (Δ106-125 nt) enhances activity 10-fold. RuvC.1 active site cleaves both DNA strands. Two-layer dimerization interface via REC domain α1 helix and loops. Shows 70% non-target strand cleavage preference.

Applications

AAV-compatible genome editing, research applications exploring Cas12f mechanistic diversity. Useful for structure-function studies of CRISPR activation mechanisms.

Limitations

Requires RuvC.2 docking for R-loop completion, creating EDx intermediate state that slows cleavage. Biphasic cleavage kinetics with slow linear approach to completion. Native gRNA contains stem 4 that reduces activity until deleted. Lower overall activity compared to Al3Cas12f RKK.

Sequence

atggcgccgaagaagaagagaaaagtaggtggtggtggaagcgggaaaggcgtactcgctaaagtcatgaaatacgaactgaggtatctcgatggctgtggggatttcagtaacatgcaagaacaagtctgggcactgcaacgccaaacgcgggaaattctgaatcggtcaatacaaattgcatttcaatgggattgtgctaactctgagcatcacaggaaaacgggagaatacctcgaccttaaaactgagactggatacaaaagattagatgggcatatttacaattgcttgaaaggacaatatgaagatatggccacttccaacctgaatgccacaatccagaaagcgtggaagaagtataattcttcaaagaaagagattttaagagggtctatgtccatccccagttataagatgaaccaacccctcacgctggacaagaatacggtcaagctctccgaaggggagcggaatcctattgtgacattgacgctgttttctgacaagttcaagcgggctcaaggcgtttctaacgtgaaatttagtatgcccctgcacgatggcacccagagggcaattttcgcgaatcttatgaatggtacgtatcaacttggggaatgccaacttgtttacaagcggcctaaatggtttctgtttgtgacctataaattcccacccgtagagcaccctctcgatcctgacaaaatcctcggtgtagacatgggcgaagcgtgcgcattatacgcctctacatttggggagcatggatacttgaaaattgacggcggggaaatcaccaaatatgcaaagaagatggaagccaggatacgatccatgcagaagcaagctgctcactgtggtgaggggcggattggtcatggtaccaaaactagggtctctgtagtataccaggcaaaggacaaagtagctcggtttcgcgataccataaaccatcgttatagcaaagcacttattgactacgcattgaagaaccagtgcggtacaatacaaatggaagacctcaccgggatcaaagaggataccggctttccaaaatttctgcggcactggacctactatgacttgcaatccaaaattgaagccaaggccgcagaacacggtatccaagttgtcaagattaacccccggcacacatcccaacgctgttcccggtgcggccatatagacaaagccaacaggactagtcaggccgatttctgttgtacaaaatgcgggttttctgcaaacgcagacttcaacgctagtcaaaatatctccatacgcaatattgataaaattatagccaaagctatcggagctaaccggaaacaaacaggcggcggtggcagtggtggcggtggatcttatccgtatgatgtgccagattatgcgtatccttacgacgtcccagactatgcatatccttatgatgtgccagattatgcatccggcgggaagcgaccggcggccaccaagaaagctggccaagcaaagaagaagaaa

Literature References

  1. Guan et al. (2025). Comparative characterization of Cas12f orthologs reveals mechanistic features underlying enhanced genome editing efficiency. Nat. Struct. Mol. Biol. - Guan 2025 Cas12f Orthologs

Related collections

1 4