SV40 Large T Antigen Nuclear Localization Signal (SV40 NLS)

The canonical nuclear localization signal from SV40 Large T antigen. Defined by Kalderon et al. (1984) as the minimal sequence sufficient to drive nuclear import via the importin-α/β pathway. The most widely used NLS in engineered nuclear-targeted proteins.

Length: 21 bp

Subtype: Nuclear localization signal

Target: Nucleus

Efficiency: >90% nuclear in mammalian cells

Origin: SV40 Large T antigen (aa 126–132: PKKKRKV)

Characteristics

Short, positively charged monopartite NLS (PKKKRKV). Recognized by importin-α, transported through nuclear pore complex. Functions constitutively in virtually all eukaryotic cell types. Can be placed at N- or C-terminus.

Applications

Directing Cas9, recombinases, transcription factors, and other proteins to the nucleus. Often used in tandem (2x SV40 NLS) for large cargo or improved efficiency. Standard NLS for most nuclear-targeted construct designs.

Limitations

Constitutively active—no conditional nuclear localization. Single copy can be insufficient for large proteins (>100 kDa); double NLS recommended. Competes with endogenous importin-α binding proteins at high expression levels.

Sequence

ccaaaaaagaagagaaaggta

Literature References

  1. Kalderon et al. (1984). A short amino acid sequence able to specify nuclear location. Cell - Kalderon 1984 SV40 NLS