Klarsicht/ANC-1/Syne Homology (KASH) Domain

The KASH domain is the conserved C-terminal transmembrane domain from nesprin/SYNE family proteins that anchors to the outer nuclear membrane (ONM). Defined by Starr & Han (2002). Used to tether proteins to the outer nuclear membrane in engineered constructs.

Length: 174 bp

Subtype: Membrane anchor

Target: Outer nuclear membrane

Efficiency: Highly efficient ONM targeting when perinuclear SUN domain partner is present

Origin: C. elegans ANC-1 / human SYNE1/SYNE2 (nesprin) family

Characteristics

~20 aa transmembrane domain + short luminal C-terminal tail that binds SUN domain proteins in the perinuclear space. Part of the LINC complex (Linker of Nucleoskeleton and Cytoskeleton). Requires the perinuclear space SUN-domain interaction for stable ONM retention.

Applications

Anchoring proteins, nanobodies, or actuators to the outer nuclear membrane. Engineering nuclear positioning. Tethering cytoskeletal elements or signaling molecules to the nuclear envelope. Used in LINC complex disruption studies.

Limitations

Requires SUN domain partners for stable retention—expression in cells lacking SUN1/SUN2 may reduce efficiency. C-terminal placement required (domain is at the natural C-terminus of nesprin proteins). Large cargo may affect nuclear positioning.

Sequence

ttcctctcaagggtgatcagggcagcgctaccgttgcagctgcttctgctgctgctgctgctcctggcctgcctgctacctgcctctgaagatgactacagctgcacccaggccaacaactttgcccgatccttctaccccatgctgcggtacaccaacgggccacctcccacc

Literature References

  1. Starr et al. (2002). Role of ANC-1 in tethering nuclei to the actin cytoskeleton. Science - Starr 2002 KASH