Cytochrome c Oxidase Subunit VIII Mitochondrial Targeting Sequence (COX8 MTS)

The N-terminal mitochondrial targeting sequence (MTS) from human cytochrome c oxidase subunit VIII (COX8). Directs proteins to the mitochondrial matrix. First used for heterologous targeting by Rizzuto et al. (1992) and since adopted as the standard mitochondria-targeting sequence for engineered constructs.

Length: 75 bp

Subtype: Mitochondrial targeting

Target: Mitochondria

Efficiency: >95% mitochondrial matrix localization in mammalian cells

Origin: Human cytochrome c oxidase subunit VIII (COX8, first 25 aa)

Characteristics

Amphipathic alpha-helix with net positive charge—characteristic of mitochondria-targeting peptides. Recognized by TOM/TIM import machinery. Cleaved by mitochondrial processing peptidase (MPP) after import, leaving the mature protein in the matrix. Fast and efficient in most mammalian cell types.

Applications

Mitochondria-targeted reporters, calcium sensors (e.g., mito-GCaMP), antioxidant enzymes, CRISPR tools for mitochondrial research. Standard sequence for any protein requiring mitochondrial matrix localization.

Limitations

Directs to the matrix specifically—not the inner membrane, intermembrane space, or outer membrane (those require different signals). Cleavage by MPP is context-dependent; verify mature protein size by western blot. May affect folding of some cargo proteins.

Sequence

atgtccgtcctgacgccgctgctgctgcggggcttgacaggctcggcccggcggctcccagtgccgcgcgccaag

Literature References

  1. Rizzuto et al. (1992). Rapid changes of mitochondrial Ca2+ revealed by specifically targeted recombinant aequorin. J Cell Biol - Rizzuto 1992 COX8 MTS