Human c-Myc Nuclear Localization Signal (cMyc NLS)

The NLS from human c-Myc oncoprotein (PAAKRVKLD). Functions as a bipartite-like basic NLS and is used as an alternative to SV40 NLS, particularly when antibody detection of the Myc tag is also desired.

Length: 27 bp

Subtype: Nuclear localization signal

Target: Nucleus

Efficiency: >85% nuclear in mammalian cells

Origin: Human c-Myc proto-oncogene

Characteristics

Basic NLS (PAAKRVKLD). Importin-α–dependent pathway, similar to SV40 NLS. Slightly lower intrinsic efficiency than SV40 NLS but fully functional. Dual utility: the 9E10 antibody recognizes the Myc tag within this sequence.

Applications

Alternative NLS when Myc-tag detection is also needed. Stacking with SV40 NLS in dual-NLS constructs for improved nuclear targeting. Used in some gene editing and base editing systems.

Limitations

Slightly weaker than SV40 NLS in direct comparisons. The 9E10 antibody recognizes this region—if antibody staining is used for other purposes, background considerations apply. Constitutively active like SV40 NLS.

Sequence

cctgctgccaagagggtcaagttggac

Literature References

  1. Evan et al. (1985). Isolation of monoclonal antibodies specific for human c-myc proto-oncogene product. Mol Cell Biol - Evan 1985 cMyc NLS