Thosea asigna Virus 2A (T2A) Self-Cleaving Peptide

Self-cleaving 2A peptide from Thosea asigna virus, the second most efficient of the four viral 2A peptides. Enables stoichiometric co-expression of two proteins from a single open reading frame without IRES elements or separate promoters. Widely used in multi-gene constructs and reporter systems.

Length: 63 bp

Subtype: 2A peptide

Cleavage efficiency: Very High (>95%)

Origin: Thosea asigna virus 2A region

Characteristics

Core 18 aa peptide (EGRGSLLTCGDVEENPGP) typically extended with a GSG N-terminal linker (21 aa total, 63 bp) to improve cleavage. Achieves >95% cleavage efficiency in human cell lines and in vivo. Leaves a short C-terminal tag on the upstream protein. Cleavage occurs between the penultimate glycine and terminal proline via ribosomal skipping rather than true proteolytic cleavage. Second only to P2A in head-to-head efficiency comparisons across HEK293T, HT1080, HeLa, zebrafish, and mouse liver.

Applications

Multi-cistronic constructs requiring stoichiometric protein co-expression. Reporter systems pairing a gene of interest with fluorescent or selection markers. CRISPR base editor and prime editor dual-component expression. Preferred over IRES when equal upstream/downstream protein levels are needed.

Limitations

Leaves a short residual peptide tag on the C-terminus of the upstream protein, which can interfere with C-terminal fusions. Slightly lower efficiency than P2A. Some incomplete cleavage products detectable by western blot at high expression levels. Not suitable when a clean C-terminus on the upstream protein is required.

Sequence

ggaagcggagagggcaggggaagtcttctaacatgcggggacgtggaggaaaatcccggcccc

Literature References

  1. Kim et al. (2011). High cleavage efficiency of a 2A peptide derived from porcine teschovirus-1 in human cell lines, zebrafish and mice. PLoS ONE - Kim 2011 P2A Cleavage