Porcine Teschovirus-1 2A (P2A) Self-Cleaving Peptide

Self-cleaving 2A peptide from porcine teschovirus-1 with the highest cleavage efficiency among viral 2A peptides. Achieves near-complete protein separation in human cell lines, zebrafish, and mouse liver, making it the default choice for multi-cistronic constructs requiring stoichiometric co-expression.

Length: 66 bp

Subtype: 2A peptide

Cleavage efficiency: Very High (>99%)

Origin: Porcine teschovirus-1 2A region

Characteristics

Core 22 aa peptide (GSGATNFSLLKQCGDVEENPGP) including GSG N-terminal linker, 66 bp coding sequence. Achieves the highest cleavage efficiency of all 2A peptides in comparative studies (>P2A > T2A > E2A > F2A). Validated across HEK293T, HT1080, and HeLa human cell lines, zebrafish embryos at 24 hpf, and mouse liver at 3 days post adenoviral injection. Cleavage results in complete nuclear and membrane localization of split NLS-EGFP and mCherry-CAAX reporter proteins. Ribosomal skipping mechanism avoids true proteolytic processing.

Applications

Default 2A peptide for multi-gene expression cassettes requiring maximum protein separation efficiency. Co-expression of CRISPR components (nuclease + base editor subunits, editor + reporter). Bicistronic AAV cassettes. Widely used to link selection markers or fluorescent reporters to transgenes for in vivo and clinical vectors.

Limitations

Like all 2A peptides, leaves a short residual peptide tag on the upstream protein's C-terminus, which can affect proteins requiring a clean C-terminal end. Introduces a proline residue at the N-terminus of the downstream protein. Efficiency can decrease in some protein folding contexts where the upstream protein C-terminus is sterically constrained.

Sequence

ggaagcggagccacgaacttctctctgttaaagcaagcaggagatgttgaagaaaaccccgggcct

Literature References

  1. Kim et al. (2011). High cleavage efficiency of a 2A peptide derived from porcine teschovirus-1 in human cell lines, zebrafish and mice. PLoS ONE - Kim 2011 P2A Cleavage