Internal Ribosome Entry Site (EMCV IRES)

RNA regulatory element from encephalomyocarditis virus (EMCV) enabling cap-independent translation of a downstream open reading frame in bicistronic mRNAs. The original tool for co-expressing two proteins from a single promoter, now largely replaced by 2A peptides for most applications due to IRES's large size (~580 bp) and unequal downstream expression (20–50% of upstream).

Length: 588 bp

Subtype: IRES

Origin: Encephalomyocarditis virus (EMCV) 5' untranslated region

Characteristics

588 bp for the widely used EMCV IRES; shorter variants (~250 bp) with reduced activity exist. Functions by directly recruiting the 40S ribosomal subunit to internal RNA secondary structure, bypassing 5' cap-dependent initiation. Does not require eIF4E or full-length eIF4G for translation initiation. Downstream (IRES-driven) protein typically expressed at 20–50% the level of upstream protein, producing unequal stoichiometry. Leaves no peptide tags on either protein, unlike 2A peptides. Cell-type and context-dependent activity — efficiency varies significantly across cell lines and in vivo conditions.

Applications: Bicistronic constructs where clean protein termini are required on both proteins and unequal expression is acceptable. Co-expression of a fluorescent reporter (downstream) at reduced levels relative to the gene of interest (upstream). Lentiviral and retroviral vectors with size budget for the ~588 bp element. Historical use in mammalian stable cell line selection cassettes (GOI-IRES-selection_marker). Research applications where 2A peptide scars are unacceptable.

Limitations: Downstream protein expressed at only 20–50% of upstream protein level — unsuitable when stoichiometric co-expression is needed. Large size (~588 bp) consumes significant vector cargo space; 2A peptides (~18–66 bp) are strongly preferred for size-constrained vectors like AAV (~4.7 kb packaging limit). Activity is cell-type and context-dependent with unpredictable efficiency. Cannot be used when equal protein levels are required. Adds substantial sequence between genes, complicating design.

Sequence

gcccctctccctcccccccccctaacgttactggccgaagccgcttggaataaggccggtgtgcgtttgtctatatgttattttccaccatattgccgtcttttggcaatgtgagggcccggaaacctggccctgtcttcttgacgagcattcctaggggtctttcccctctcgccaaaggaatgcaaggtctgttgaatgtcgtgaaggaagcagttcctctggaagcttcttgaagacaaacaacgtctgtagcgaccctttgcaggcagcggaaccccccacctggcgacaggtgcctctgcggccaaaagccacgtgtataagatacacctgcaaaggcggcacaaccccagtgccacgttgtgagttggatagttgtggaaagagtcaaatggctctcctcaagcgtattcaacaaggggctgaaggatgcccagaaggtaccccattgtatgggatctgatctggggcctcggtgcacatgctttacatgtgtttagtcgaggttaaaaaaacgtctaggccccccgaaccacggggacgtggttttcctttgaaaaacacgatgataatatggccacaacc

You must be signed in to view the full sequence.

Sign in / Register

References

Jang et al. (1988). A segment of the 5' nontranslated region of encephalomyocarditis virus RNA directs internal entry of ribosomes during in vitro translation. Journal of Virology - Jang 1988 EMCV IRES
Kim et al. (2011). High cleavage efficiency of a 2A peptide derived from porcine teschovirus-1 in human cell lines, zebrafish and mice. PLoS ONE - Kim 2011 P2A Cleavage
Daniels et al. (2014). Expression of Multiple Transgenes from a Single Construct Using Viral 2A Peptides in Drosophila. PLoS ONE - Daniels 2014 2A Peptides
Diao & White (2011). A Novel Approach for Directing Transgene Expression in Drosophila: T2A-Gal4 In-Frame Fusion. Genetics - Diao 2011 T2A Gal4