Foot-and-Mouth Disease Virus 2A (F2A) Self-Cleaving Peptide

Self-cleaving 2A peptide from foot-and-mouth disease virus, the least efficient of the four commonly used viral 2A peptides. Primarily used in multi-gene constructs requiring a fourth distinct 2A sequence to minimize recombination risk between repeated 2A elements.

Length: 75 bp

Subtype: 2A peptide

Cleavage efficiency: Moderate (<90%)

Origin: Foot-and-mouth disease virus (FMDV) 2A region

Characteristics

Core 23 aa peptide (VKQTLNFDLLKLAGDVESNPGP), 69 bp coding sequence, the longest of the four 2A peptides. Exhibits the lowest cleavage efficiency in comparative studies across human cell lines, zebrafish, and mouse liver. Like all 2A peptides, uses a ribosomal skipping mechanism. Its distinct sequence is its primary advantage — enabling use alongside P2A, T2A, and E2A in polycistronic constructs without introducing repeated sequences that risk recombination.

Applications

Fourth 2A site in tetracistronic constructs where P2A, T2A, and E2A are already used. Experimental designs requiring all four 2A peptides to compare cleavage behavior. Contexts where sequence diversity is more important than maximum cleavage efficiency.

Limitations

Lowest cleavage efficiency of the four 2A peptides. Produces the most residual uncleaved fusion protein in comparative studies. Rarely the first choice for two-protein or three-protein co-expression; use P2A or T2A instead.

Sequence

ggaagcggagtgaaacagactttgaattttgaccttctgaagttggcaggagacgttgagtccaaccctgggccc

Literature References

  1. Kim et al. (2011). High cleavage efficiency of a 2A peptide derived from porcine teschovirus-1 in human cell lines, zebrafish and mice. PLoS ONE - Kim 2011 P2A Cleavage