Equine Rhinitis A Virus 2A (E2A) Self-Cleaving Peptide

Self-cleaving 2A peptide from equine rhinitis A virus, third in efficiency among the four viral 2A peptides. Used in multi-cistronic constructs where P2A and T2A are unsuitable due to sequence context constraints or repeated element concerns.

Length: 69 bp

Subtype: 2A peptide

Cleavage efficiency: High (90–95%)

Origin: Equine rhinitis A virus 2A region

Characteristics

Core 20 aa peptide (QCTNYALLKLAGDVESNPGP), 60 bp coding sequence. Cleavage efficiency is lower than P2A and T2A but higher than F2A in head-to-head comparisons across human cell lines and in vivo models. Uses the same ribosomal skipping mechanism. Provides a useful alternative when sequence diversity among 2A sites is needed to avoid recombination in vectors containing multiple 2A elements. Often combined with P2A or T2A in tricistronic constructs.

Applications

Tricistronic constructs requiring a third distinct 2A sequence to minimize recombination risk between repeated elements. Situations where sequence diversity across multiple 2A sites in a single vector is required. Alternative when P2A or T2A show context-dependent cleavage issues.

Limitations

Lower cleavage efficiency than P2A and T2A. More residual uncleaved fusion protein detectable by western blot compared to P2A. Less commonly used as a primary 2A element; mainly chosen for sequence diversity purposes.

Sequence

ggaagcggacagtgtactaattatgctctcttgaaattggctggagatgttgagagcaacccaggtccc

Literature References

  1. Kim et al. (2011). High cleavage efficiency of a 2A peptide derived from porcine teschovirus-1 in human cell lines, zebrafish and mice. PLoS ONE - Kim 2011 P2A Cleavage