Venus Yellow Fluorescent Protein (Venus YFP)

Optimized yellow fluorescent protein (515/528 nm) derived from EYFP with F46L mutation enabling efficient maturation at 37°C in mammalian cells. ~2-fold brighter than EYFP with superior signal in standard YFP/FITC filter sets. Widely used as a FRET acceptor paired with CFP/ECFP and as a general yellow reporter in mammalian systems.

Length: 720 bp(240 aa)

Excitation: 515 nm

Emission: 528 nm

Brightness: Very High

Photostability: Moderate

Maturation: <30 min

Origin: Aequorea victoria (engineered)

Characteristics

The most widely used yellow fluorescent protein (YFP) variant, and a major improvement over parent EYFP (enhanced yellow fluorescent protein). Derived from EYFP by the F46L mutation plus stabilizing substitutions M153T, V163A, and S175G. F46L is the key improvement — it accelerates chromophore maturation at 37°C, making Venus ~2× brighter than EYFP in mammalian cells. Spectral properties: excitation 515 nm, emission 528 nm; extinction coefficient 92,200 M⁻¹cm⁻¹; quantum yield 0.57; molecular weight 26.9 kDa. pH-sensitive (pKa ~6.0) — fluorescence quenched in acidic organelles. Moderate photostability. Excellent FRET acceptor with ECFP or mTurquoise2 (CFP–YFP FRET pair).

Applications

FRET acceptor in CFP-YFP FRET pairs. Yellow channel in multicolor panels. BiFC (bimolecular fluorescence complementation) split-Venus for protein interaction assays.

Limitations

pH-sensitive (pKa ~6.0)—signal drops in acidic compartments. Moderate photostability. Spectrally close to EGFP; requires good filter sets to separate in two-color imaging.

Sequence

atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagctgatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgggctacggcctgcagtgcttcgcccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcaccgccgacaagcagaagaacggcatcaaggccaacttcaagatccgccacaacatcgaggacggcggcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa

Literature References

  1. Nagai et al. (2002). A variant of yellow fluorescent protein with fast and efficient maturation for cell-biological applications. Nat Biotechnol - Nagai 2002 Venus