Tandem Dimer Tomato (tdTomato) Fluorescent Protein

Brightest commonly used red fluorescent protein (554/581 nm) formed by tandem fusion of two dTomato units, yielding ~4-fold greater brightness than mCherry with excellent photostability. Ideal for applications requiring maximum signal, though the 105 kDa tandem dimer structure is incompatible with fusion tags on proteins sensitive to oligomerization.

Length: 1431 bp(477 aa)

Excitation: 554 nm

Emission: 581 nm

Brightness: Very High

Photostability: Good

Maturation: <1 hr

Origin: Discosoma sp. (engineered tandem dimer)

Characteristics

Tandem dimer red fluorescent protein formed by two dTomato units connected head-to-tail by a short linker. Spectral properties: extinction coefficient 138,000 M⁻¹cm⁻¹ (per tandem unit); quantum yield 0.69; molecular weight ~54 kDa per subunit, ~108 kDa as the obligate tandem dimer. Exceptionally bright — ~4-fold brighter than mCherry because each molecule carries two chromophores. Good photostability. The tandem design enforces obligate intramolecular dimerization, making it non-oligomerizing at the cell biology level.

Applications

Applications requiring maximum sensitivity: single-copy reporters, low-abundance protein detection, in vivo imaging. Good where brightness outweighs the larger coding sequence size.

Limitations

Large coding sequence (1431 bp vs 711 bp for mCherry) — significant constraint for size-limited vectors (e.g., AAV). The ~108 kDa tandem dimer is not suitable for fusion proteins where the large size or forced proximity of two fluorophores would be problematic. Cannot be split into N- and C-terminal halves like canonical monomers.

Sequence

atggtgagcaagggcgaggaggtcatcaaagagttcatgcgcttcaaggtgcgcatggagggctccatgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggcggccccctgcccttcgcctgggacatcctgtccccccagttcatgtacggctccaaggcgtacgtgaagcaccccgccgacatccccgattacaagaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggtctggtgaccgtgacccaggactcctccctgcaggacggcacgctgatctacaaggtgaagatgcgcggcaccaacttcccccccgacggccccgtaatgcagaagaagaccatgggctgggaggcctccaccgagcgcctgtacccccgcgacggcgtgctgaagggcgagatccaccaggccctgaagctgaaggacggcggccactacctggtggagttcaagaccatctacatggccaagaagcccgtgcaactgcccggctactactacgtggacaccaagctggacatcacctcccacaacgaggactacaccatcgtggaacagtacgagcgctccgagggccgccaccacctgttcctggggcatggcaccggcagcaccggcagcggcagctccggcaccgcctcctccgaggacaacaacatggccgtcatcaaagagttcatgcgcttcaaggtgcgcatggagggctccatgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggcggccccctgcccttcgcctgggacatcctgtccccccagttcatgtacggctccaaggcgtacgtgaagcaccccgccgacatccccgattacaagaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggtctggtgaccgtgacccaggactcctccctgcaggacggcacgctgatctacaaggtgaagatgcgcggcaccaacttcccccccgacggccccgtaatgcagaagaagaccatgggctgggaggcctccaccgagcgcctgtacccccgcgacggcgtgctgaagggcgagatccaccaggccctgaagctgaaggacggcggccactacctggtggagttcaagaccatctacatggccaagaagcccgtgcaactgcccggctactactacgtggacaccaagctggacatcacctcccacaacgaggactacaccatcgtggaacagtacgagcgctccgagggccgccaccacctgttcctgtacggcatggacgagctgtacaagtag

Literature References

  1. Shaner et al. (2004). Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat Biotechnol - Shaner 2004 mFruits