Monomeric Orange 2 (mOrange2) Fluorescent Protein

Improved orange fluorescent protein (549/565 nm) derived from mOrange with ~4-fold greater photostability through targeted mutagenesis. Fills the spectral gap between green (EGFP) and red (mCherry) FPs for three-color imaging panels, with sufficient separation from both to minimize bleed-through on standard confocal filter sets.

Length: 711 bp(237 aa)

Excitation: 549 nm

Emission: 565 nm

Brightness: High

Photostability: Good

Maturation: 1-2 hr

Origin: Discosoma sp. (engineered)

Characteristics

Monomeric orange fluorescent protein. Spectral properties: excitation 549 nm, emission 565 nm; extinction coefficient 71,000 M⁻¹cm⁻¹; quantum yield 0.60; molecular weight 28.0 kDa. Coding sequence 711 bp encoding 236 amino acids. Emission at 565 nm fills the spectral gap between EGFP (507 nm) and mCherry (610 nm), enabling clean multicolor separation on standard confocal filter sets with 532 nm or 543/561 nm laser excitation. ~4-fold improvement in photostability over original mOrange through targeted mutagenesis.

Applications

Orange channel in multicolor panels where spectral separation from EGFP and mCherry is needed. Second color in dual-reporter designs with EGFP.

Limitations

Slower maturation than EGFP or mCherry. Some spectral overlap with both YFP/Venus and mCherry—careful filter selection required for three-color panels including all three.

Sequence

atggtgagcaagggcgaggagaataacatggccatcatcaaggagttcatgcgcttcaaggtgcgcatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggctttcagaccgctaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcatttcacctacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttcaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaactacgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtgatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggtgccctgaagggcaagatcaagatgaggctgaagctgaaggacggcggccactacacctccgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacatcgtcgacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtga

Literature References

  1. Shaner et al. (2004). Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat Biotechnol - Shaner 2004 mFruits