Monomeric Cherry (mCherry) Fluorescent Protein

Obligate monomeric red fluorescent protein (587/610 nm) with best-in-class photostability among common red reporters, enabling long-term timelapse imaging without bleaching artifacts. Fast maturation (<1 hr at 37°C) with full tolerance to N- and C-terminal fusions. Most widely used red channel partner for EGFP in two-color mammalian cell imaging.

Length: 711 bp(237 aa)

Excitation: 587 nm

Emission: 610 nm

Brightness: Moderate

Photostability: Excellent

Maturation: <1 hr

Origin: Discosoma sp. (engineered)

Characteristics

Obligate monomer — no dimerization artifacts at any expression level. Excitation at 587 nm (561 nm laser line optimal), emission at 610 nm. Exceptional photostability, best among common red fluorescent proteins. Molecular weight 28.8 kDa; coding sequence 711 bp. Moderate brightness (~47% of EGFP; extinction coefficient 72,000 M⁻¹cm⁻¹; quantum yield 0.22). Fast maturation at 37°C (<1 hr). Tolerates both N- and C-terminal fusion tags without loss of monomericity.

Applications

Red fluorescent protein channel partner for EGFP in two-color live-cell imaging. Fusion tag for any protein where an obligate-monomeric red reporter is required — N- or C-terminal fusions equally well-tolerated. Long-term timelapse where red channel photostability matters. Transcriptional reporters in dual-reporter (red/green) systems. Detected by anti-mCherry and anti-RFP antibodies for western blot and immunofluorescence.

Limitations

Lower brightness than tdTomato. Excitation at 587 nm means 561 nm laser is preferred—less efficient with 532 nm. Weak excitation at 514 nm (some bleedthrough into YFP channel).

Sequence

atggtgagcaagggcgaggaggataacatggccatcatcaaggagttcatgcgcttcaaggtgcacatggagggctccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggcacccagaccgccaagctgaaggtgaccaagggtggccccctgcccttcgcctgggacatcctgtcccctcagttcatgtacggctccaaggcctacgtgaagcaccccgccgacatccccgactacttgaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggtgaccgtgacccaggactcctccctgcaggacggcgagttcatctacaaggtgaagctgcgcggcaccaacttcccctccgacggccccgtaatgcagaagaagaccatgggctgggaggcctcctccgagcggatgtaccccgaggacggcgccctgaagggcgagatcaagcagaggctgaagctgaaggacggcggccactacgacgctgaggtcaagaccacctacaaggccaagaagcccgtgcagctgcccggcgcctacaacgtcaacatcaagttggacatcacctcccacaacgaggactacaccatcgtggaacagtacgaacgcgccgagggccgccactccaccggcggcatggacgagctgtacaagtaa

Literature References

  1. Shaner et al. (2004). Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat Biotechnol - Shaner 2004 mFruits