Enhanced Green Fluorescent Protein (EGFP)

EGFP is the F64L/S65T double mutant of wild-type GFP from Aequorea victoria. The F64L mutation stabilizes the chromophore environment; the S65T mutation shifts excitation to 488 nm and accelerates chromophore oxidation. EGFP is the most widely used fluorescent reporter in molecular biology.

Length: 720 bp(240 aa)

Excitation: 488 nm

Emission: 507 nm

Brightness: High

Photostability: Moderate

Maturation: <30 min

Origin: Aequorea victoria (engineered)

Characteristics

Monomeric at typical expression levels. Excitation peak at 488 nm is perfectly matched to argon-ion and 488 nm diode lasers. ~35-fold brighter than wild-type GFP. pH-sensitive below pH 6. Moderate photobleaching.

Applications

General-purpose green reporter for live and fixed imaging. Protein tagging, transcriptional reporters, FRET donor (with YFP). Compatible with GFP filter sets on any fluorescence microscope.

Limitations

Moderate photostability limits long-term timelapse imaging. Dimerization tendency at high concentrations—use monomeric variants (mEGFP, A206K) for fusion proteins where oligomerization would be problematic.

Sequence

atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa

Literature References

  1. Prasher et al. (1992). Primary structure of the Aequorea victoria green-fluorescent protein. Gene - Prasher 1992 GFP Cloning
  2. Chalfie et al. (1994). Green fluorescent protein as a marker for gene expression. Science - Chalfie 1994 GFP Reporter
  3. Cormack et al. (1996). FACS-optimized mutants of the green fluorescent protein (GFP). Gene - Cormack 1996 EGFP