Enhanced Green Fluorescent Protein (EGFP)

Gold-standard green fluorescent reporter (488/507 nm) engineered from Aequorea victoria GFP, with ~35-fold greater brightness than wild-type via F64L/S65T mutations. Excitation peak perfectly matched to 488 nm laser lines on standard confocal and flow cytometry systems. The default choice for gene expression reporters, protein localization, and live-cell imaging across virtually all model organisms.

Length: 720 bp(240 aa)

Excitation: 488 nm

Emission: 507 nm

Brightness: High

Photostability: Moderate

Maturation: <30 min

Origin: Aequorea victoria (engineered)

Characteristics

Defined by two point mutations relative to wild-type Aequorea victoria GFP: F64L and S65T. F64L (phenylalanine to leucine at residue 64) enhances protein folding at 37°C; S65T (serine to threonine at residue 65) shifts the excitation peak from 395 nm to 488 nm and increases the molar extinction coefficient ~6-fold. Together, F64L and S65T produce ~35-fold greater brightness than wild-type GFP. Spectral properties: extinction coefficient 55,900 M⁻¹cm⁻¹; quantum yield 0.60; molecular weight 26.9 kDa. Coding sequence is 720 bp encoding 239 amino acids. Monomeric at physiological expression levels (use A206K mutation for obligate monomer at high concentrations). pH-sensitive below pH 6.0 (pKa ≈ 6.0). Moderate photobleaching under sustained high-intensity illumination.

Applications

General-purpose green reporter for live-cell and fixed imaging. Protein tagging, transcriptional reporters, FRET donor paired with Venus or YFP. Detected by anti-GFP antibodies for western blot, immunoprecipitation, and immunofluorescence. Compatible with GFP filter sets on any fluorescence microscope or flow cytometer.

Limitations

Moderate photostability limits long-term timelapse imaging. Dimerization tendency at high concentrations—use monomeric variants (mEGFP, A206K) for fusion proteins where oligomerization would be problematic.

Sequence

atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa

Literature References

  1. Prasher et al. (1992). Primary structure of the Aequorea victoria green-fluorescent protein. Gene - Prasher 1992 GFP Cloning
  2. Chalfie et al. (1994). Green fluorescent protein as a marker for gene expression. Science - Chalfie 1994 GFP Reporter
  3. Cormack et al. (1996). FACS-optimized mutants of the green fluorescent protein (GFP). Gene - Cormack 1996 EGFP