Escherichia coli maltose-binding protein

Escherichia coli maltose-binding protein, a 366-residue protein of about 40 kDa encoded by malE, used as a fusion partner. It can increase the solubility of the protein it is fused to when expressed in bacteria, and it binds amylose resin, so one tag allows both solubilization and affinity purification.

Length: 1098 bp (366 aa)

Uses: solubility, purification

Cleavable: No

Detected by: amylose resin, anti-MBP antibody

Origin: Escherichia coli maltose-binding protein (malE)

Characteristics

Encodes a 366-amino-acid protein of 1098 nucleotides, beginning KIEEGKLV and ending EALKDAQT. This is the mature protein without its periplasmic signal sequence, so it is made in the cytoplasm when fused. Fusions bind cross-linked amylose with micromolar affinity and elute with 10 mM maltose in physiological buffer; buffers are compatible from pH 7.0-8.5 and up to 1 M salt, and denaturing agents cannot be used. MBP can increase the solubility of overexpressed fusions in bacteria, especially eukaryotic proteins. As N-terminal fusions to 23 human proteins in E. coli KRX, 52% were soluble.

Applications: Increasing the yield of soluble recombinant protein in Escherichia coli and purifying it on amylose resin, often together with a small affinity tag such as His6. Detected by immunoassay. Used as a carrier for crystallization, with more than 25 structures determined as MBP fusions.

Limitations: MBP fusions often fail to bind amylose resin; with TEV cleavage, MBP-purified proteins were 30-60% pure because free MBP is released. MBP changes conformation with and without maltose, which causes heterogeneity. Solubilization is not guaranteed, and two defensins needed refolding. At 1098 nucleotides it is large.

Sequence

acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtac

You must be signed in to view the full sequence.

References

K. Terpe (2003). Overview of tag protein fusions: from molecular and biochemical fundamentals to commercial systems. Appl Microbiol Biotechnol - Terpe 2003 Tag Fusions
Ohana et al. (2009). HaloTag7: A genetically engineered tag that enhances bacterial expression of soluble proteins and improves protein purification. Protein Expr Purif - Ohana 2009 HaloTag7
Bell et al. (2013). To fuse or not to fuse: what is your purpose?. Protein Sci - Bell 2013 Fusion Purpose