Human immunoglobulin G Fc region

Fc region of human immunoglobulin G, covering the hinge, CH2 and CH3 domains. Fused to a protein of interest it forms a disulfide-linked homodimer that is purified on Protein A or Protein G resin and detected with anti-human Fc antibodies.

Length: 681 bp (227 aa)

Uses: purification, solubility, multimerization

Cleavable: No

Detected by: Protein A resin, Protein G resin, anti-human IgG Fc antibody

Origin: Human IgG heavy-chain hinge, CH2 and CH3 domains

Characteristics

Encodes a 227-amino-acid protein of 681 nucleotides, beginning DKTHTCPP and ending SLSLSPGK. Two Fc chains are disulfide-bonded through the hinge region, so Fc-fusions are expressed as homodimers, which increases the avidity of the fused partner relative to the isolated partner. Fc-fusions are purified by Protein G or Protein A affinity chromatography. The Fc domain folds independently, can improve the solubility and stability of the partner, and has been used to enhance expression in mammalian cells of proteins that are otherwise difficult to produce. Binding to the neonatal Fc receptor (FcRn) markedly increases the plasma half-life of the fusion. In transfected 293T cells, fusing human IgG Fc to enterovirus 71 VP1 (with a tPA leader) gave the highest VP1 secretion among four constructs.

Applications: Receptor-Fc and ligand-Fc fusion reagents, capture on Protein A or Protein G resin, and bait proteins attached to Protein G or A surfaces in protein microarrays. Also used in flow cytometry and immunohistochemistry reagents. Fc-fusion therapeutics include etanercept, a TNF receptor fused to a human IgG Fc, where the Fc extends plasma half-life. As a DNA vaccine fusion, enterovirus 71 VP1-hFc gave the highest antibody response in BALB/c mice among four VP1 constructs.

Limitations: As a homodimer, a fused partner may not bind its target with sufficient affinity, and whether a fused partner keeps its activity on an Fc domain depends on the partner and must be determined for each molecule. The Fc domain interacts with Fc receptors on immune cells. Protein G or A surfaces used to capture Fc-fusions can yield false-positive interactions in interaction screens.

Sequence

acgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgtacgta

You must be signed in to view the full sequence.

References

Xu et al. (2016). Human IgG Fc promotes expression, secretion and immunogenicity of enterovirus 71 VP1 protein. J Biomed Res - Xu 2016 IgG Fc Expression