Simian Virus 40 Late (SV40) PolyA Signal

Most widely used polyadenylation signal in mammalian expression vectors, derived from SV40 late gene region.

Length: 222 bp

Efficiency: High

Transcript stability: Enhanced mRNA stability and translation efficiency through proper 3' end processing

Origin: Simian Virus 40 (SV40) late gene region

Characteristics

Complex structure with efficiency elements both upstream and downstream of AAUAAA hexanucleotide. Contains three defined downstream elements (two U-rich and one G-rich) instead of single element found in most polyA signals. Highly efficient cleavage and polyadenylation. Forms functionally significant secondary structure. Cleavage occurs 16 nucleotides downstream of AAUAAA motif. More resistant to intracellular degradation than other signals.

Applications

Standard terminator in virtually all mammalian expression vectors including lentiviral and retroviral systems. Widely validated across cell types and organisms. Default choice for research-grade plasmids. Extensively characterized with decades of literature precedent. Compatible with all mammalian promoters and coding sequences.

Limitations

Larger than minimal polyA signals (~237 bp vs ~50-100 bp for alternatives), consuming cargo space in size-constrained vectors like AAV. Contains homopurine-rich tracts that can be nuclease-labile. May show slightly lower expression than bGH polyA in some contexts.

Sequence

cagacatgataagatacattgatgagtttggacaaaccacaactagaatgcagtgaaaaaaatgctttatttgtgaaatttgtgatgctattgctttatttgtaaccattataagctgcaataaacaagttaacaacaacaattgcattcattttatgtttcaggttcagggggaggtgtgggaggttttttaaagcaagtaaaacctctacaaatgtggta

Literature References

  1. Pfarr et al. (1986). Differential effects of polyadenylation regions on gene expression in mammalian cells. DNA - Pfarr 1986 PolyA Comparison