Synthetic Polyadenylation Signal (SPA)

Minimal synthetic polyadenylation signal based on rabbit β-globin, optimized for efficiency in minimal sequence space.

Length: 49 bp

Efficiency: High

Transcript stability: Equivalent to natural signals despite minimal size; enhanced plasmid nuclease resistance

Origin: Synthetic, designed from rabbit β-globin gene polyA signal

Characteristics

Ultra-compact design (~50 bp) with minimal sequence requirements: AAUAAA hexanucleotide plus GT/T-rich sequence spaced 22-23 nucleotides apart. More extensive GT/T-rich sequence than natural globin signals provides high efficiency. Demonstrates nuclease resistance superior to bGH polyA. Achieves highest plasmid copy numbers in transfected cells. Performs equivalently to much larger natural polyA signals.

Applications

Size-critical applications requiring maximum cargo space in AAV or other vectors. Dual-function constructs where space savings enable additional elements. Plasmid-based applications where nuclease resistance and copy number are important. Gene therapy vectors approaching packaging limits.

Limitations

Less extensively validated in vivo compared to SV40 and bGH polyA signals. May show context-dependent efficiency. Minimal literature precedent for troubleshooting. Reduced redundancy compared to longer natural signals.

Sequence

aataaaagatctttattttcattagatctgtgtgttggttttttgtgtg

Literature References

  1. Levitt et al. (1989). Definition of an efficient synthetic poly(A) site. Genes Dev - Levitt 1989 Synthetic PolyA