Monomeric Tag Blue Fluorescent Protein 2 (mTagBFP2)

Best-in-class monomeric blue fluorescent protein (399/454 nm) with a quantum yield of 0.64 and ~2-fold greater photostability than TagBFP. Efficiently excited by the 405 nm violet laser on standard confocal and flow cytometry systems. Preferred blue channel FP for multi-color live-cell imaging and as a FRET donor to GFP/YFP variants.

Length: 702 bp(234 aa)

Excitation: 399 nm

Emission: 454 nm

Brightness: High

Photostability: Good

Maturation: <1 hr

Origin: Entacmaea quadricolor (engineered)

Characteristics

Best-in-class monomeric blue fluorescent protein. Spectral properties: extinction coefficient 52,000 M⁻¹cm⁻¹; quantum yield 0.64; molecular weight 26.5 kDa. Efficiently excited by the 405 nm violet laser, standard on modern confocal systems and flow cytometers. Emission at 454 nm is well separated from GFP (507 nm) and Venus/YFP (528 nm) channels. ~2-fold greater photostability than parent TagBFP. Derived from sea anemone Entacmaea quadricolor, not Aequorea victoria — no cross-reactivity with anti-GFP antibodies.

Applications

Third color in multicolor panels using 405/488/561 nm lasers. Blue channel where a monomeric, non-Aequorea-derived blue FP is needed. Useful when ECFP/mTurquoise2 is reserved for FRET.

Limitations

Requires 405 nm laser—not available on all microscope configurations. UV/violet excitation can increase phototoxicity in sensitive experiments. Not suitable as a FRET partner due to spectral distance from common acceptors.

Sequence

atgagcgagctgattaaggagaacatgcacatgaagctgtacatggagggcaccgtggacaaccatcacttcaagtgcacatccgagggcgaaggcaagccctacgagggcacccagaccatgagaatcaaggtggtcgagggcggccctctccccttcgccttcgacatcctggctactagcttcctctacggcagcaagaccttcatcaaccacacccagggcatccccgacttcttcaagcagtccttccctgagggcttcacatgggagagagtcaccacatacgaagacgggggcgtgctgaccgctacccaggacaccagcctccaggacggctgcctcatctacaacgtcaagatcagaggggtgaacttcacatccaacggccctgtgatgcagaagaaaacactcggctgggaggccttcaccgagacgctgtaccccgctgacggcggcctggaaggcagaaacgacatggccctgaagctcgtgggcgggagccatctgatcgcaaacgccaagaccacatatagatccaagaaacccgctaagaacctcaagatgcctggcgtctactatgtggactacagactggaaagaatcaaggaggccaacaacgagacctacgtcgagcagcacgaggtggcagtggccagatactgcgacctccctagcaaactggggcacaagcttaattga

Literature References

  1. Subach et al. (2011). An Enhanced Monomeric Blue Fluorescent Protein with the High Chemical Stability of the Chromophore. PLoS ONE - Subach 2011 mTagBFP2